Transcript: Human XM_017018388.2

PREDICTED: Homo sapiens phosphatidylinositol binding clathrin assembly protein (PICALM), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PICALM (8301)
Length:
3451
CDS:
260..1984

Additional Resources:

NCBI RefSeq record:
XM_017018388.2
NBCI Gene record:
PICALM (8301)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018388.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230158 TGACGCAACCAACCTTAATAT pLKO_005 1893 CDS 100% 15.000 21.000 N PICALM n/a
2 TRCN0000119074 CTACATTTATTAGGCGGTATA pLKO.1 621 CDS 100% 10.800 15.120 N PICALM n/a
3 TRCN0000230157 GGCAATCTTGGCATCGGAAAT pLKO_005 1646 CDS 100% 10.800 15.120 N PICALM n/a
4 TRCN0000119075 CCTAGCAAGTTAGTATCTGAT pLKO.1 1595 CDS 100% 4.950 6.930 N PICALM n/a
5 TRCN0000119076 CGTATCCAAGACAGTATGCAA pLKO.1 322 CDS 100% 3.000 4.200 N PICALM n/a
6 TRCN0000230156 GCACCAGCCATTGACATATTT pLKO_005 1370 CDS 100% 15.000 10.500 N PICALM n/a
7 TRCN0000313326 GCACCAGCCATTGACATATTT pLKO_005 1370 CDS 100% 15.000 10.500 N Picalm n/a
8 TRCN0000230155 GAATTGACAGAGGTGATATAC pLKO_005 1032 CDS 100% 13.200 9.240 N PICALM n/a
9 TRCN0000119073 CCTCCACAAATGGGAAGTGTT pLKO.1 1865 CDS 100% 4.950 3.465 N PICALM n/a
10 TRCN0000113186 GCAGCATACAATGAAGGAATT pLKO.1 884 CDS 100% 0.000 0.000 N Picalm n/a
11 TRCN0000218840 TGCCATGTTATGATCATATAC pLKO_005 3041 3UTR 100% 13.200 7.920 N PICALM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018388.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01884 pDONR223 100% 94% 94% None 1257_1258ins108 n/a
2 ccsbBroad304_01884 pLX_304 0% 94% 94% V5 1257_1258ins108 n/a
3 TRCN0000480673 ATGGTAAACCCTCTATTCGATGTC pLX_317 18.6% 94% 94% V5 1257_1258ins108 n/a
Download CSV