Transcript: Human XM_017019775.2

PREDICTED: Homo sapiens RNA binding motif single stranded interacting protein 2 (RBMS2), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBMS2 (5939)
Length:
8290
CDS:
64..1230

Additional Resources:

NCBI RefSeq record:
XM_017019775.2
NBCI Gene record:
RBMS2 (5939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240453 CGATCCCTTGCTTTGCAAATT pLKO_005 636 CDS 100% 13.200 18.480 N RBMS2 n/a
2 TRCN0000183067 CACAAACAAATGTAAAGGCTA pLKO.1 282 CDS 100% 2.640 3.696 N RBMS2 n/a
3 TRCN0000148972 GATTGTTTCCACTAAGGCCAT pLKO.1 249 CDS 100% 2.160 3.024 N RBMS2 n/a
4 TRCN0000240450 ACGTTCCTGCCCTTTACTATT pLKO_005 1401 3UTR 100% 13.200 9.240 N RBMS2 n/a
5 TRCN0000220045 CAGCAGCACAGGCACGTATAT pLKO.1 1053 CDS 100% 13.200 9.240 N RBMS2 n/a
6 TRCN0000220046 GGTCGCAGCTTCTCATCTATA pLKO.1 1560 3UTR 100% 13.200 9.240 N RBMS2 n/a
7 TRCN0000240451 CTTTCCAGTTCAACAAGTAAC pLKO_005 1211 CDS 100% 10.800 7.560 N RBMS2 n/a
8 TRCN0000240452 TGGATGCACCACCATTCATAC pLKO_005 922 CDS 100% 10.800 7.560 N RBMS2 n/a
9 TRCN0000147072 CAAATGTAAAGGCTATGGCTT pLKO.1 288 CDS 100% 2.640 1.848 N RBMS2 n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 5402 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4865 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4865 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06849 pDONR223 100% 94.6% 94.5% None (many diffs) n/a
2 ccsbBroad304_06849 pLX_304 0% 94.6% 94.5% V5 (many diffs) n/a
3 TRCN0000467859 TAGTCCCAGCCGATTTAAATTCGT pLX_317 25.4% 94.6% 94.5% V5 (many diffs) n/a
Download CSV