Construct: ORF TRCN0000467859
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014211.1_s317c1
- Derived from:
- ccsbBroadEn_06849
- DNA Barcode:
- TAGTCCCAGCCGATTTAAATTCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBMS2 (5939)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467859
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5939 | RBMS2 | RNA binding motif single st... | NM_002898.4 | 99.9% | 100% | 79T>C |
| 2 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_006719544.4 | 99.9% | 100% | 79T>C |
| 3 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_011538640.3 | 99.9% | 100% | 79T>C |
| 4 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_011538639.2 | 97.4% | 85% | 79T>C;1056_1057insGGCAC;1217_1242del |
| 5 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_017019775.2 | 94.6% | 94.5% | (many diffs) |
| 6 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_005269061.3 | 94.6% | 93.8% | (many diffs) |
| 7 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_024449117.1 | 92.6% | 92.6% | 0_1ins90 |
| 8 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_005269060.5 | 91.4% | 84.9% | (many diffs) |
| 9 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_006719543.4 | 91.4% | 85% | (many diffs) |
| 10 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_005269059.5 | 90% | 81.6% | 79T>C;1056_1057insGGCAC;1217_1344del |
| 11 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_006719542.4 | 86.9% | 75.4% | (many diffs) |
| 12 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_006719541.4 | 84.6% | 75.2% | 79T>C;1056_1057insGGCAC;1217_1431del |
| 13 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_011538637.3 | 80.1% | 70.6% | (many diffs) |
| 14 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_024449115.1 | 78.4% | 69% | 0_1ins90;966_967insGGCAC;1127_1341del |
| 15 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_024449116.1 | 78.4% | 69% | 0_1ins90;966_967insGGCAC;1127_1341del |
| 16 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_011538638.3 | 72.4% | 60.2% | (many diffs) |
| 17 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_011538642.3 | 58.5% | 49.2% | 0_1ins375;681_682insGGCAC;842_1056del |
| 18 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_017019778.2 | 57% | 55.7% | (many diffs) |
| 19 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_005269066.4 | 49.4% | 42% | (many diffs) |
| 20 | human | 5939 | RBMS2 | RNA binding motif single st... | XM_017019777.2 | 46.8% | 37.6% | 0_1ins543;513_514insGGCAC;674_888del |
| 21 | human | 5939 | RBMS2 | RNA binding motif single st... | XR_002957368.1 | 13.6% | (many diffs) | |
| 22 | mouse | 56516 | Rbms2 | RNA binding motif, single s... | NM_019711.2 | 80.3% | 83.2% | (many diffs) |
| 23 | mouse | 56516 | Rbms2 | RNA binding motif, single s... | XM_006513899.2 | 80.3% | 83.2% | (many diffs) |
| 24 | mouse | 56516 | Rbms2 | RNA binding motif, single s... | XM_006513900.2 | 80.3% | 83.2% | (many diffs) |
| 25 | mouse | 56516 | Rbms2 | RNA binding motif, single s... | NM_001039080.1 | 74.2% | 76.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1287
- ORF length:
- 1221
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gctatccgtg acttccaggc ccgggatttc gacttttggc tacaatagaa 121 acaacaagaa gccatatgtg tcactggctc agcagatggc accacctagc ccaagcaaca 181 gtacacctaa cagcagtagt ggaagcaatg gaaatgacca gctgagcaaa accaacctat 241 acatccgagg attgcaacca ggcactactg accaagatct tgtcaagctg tgtcagccat 301 atggcaagat tgtttccact aaggccatac tggacaagac cacaaacaaa tgtaaaggct 361 atggctttgt agattttgac agcccttcag cagcacagaa agctgtaaca gcactgaagg 421 ccagcggtgt acaggcacag atggcaaagc aacaggaaca ggaccccaca aatttataca 481 tctcaaacct cccactgtca atggatgagc aggaactgga ggggatgctg aagccctttg 541 gccaggttat ctccacccgt atccttcgag ataccagtgg gaccagcaga ggtgttggct 601 ttgcaaggat ggagtccaca gagaagtgtg aagccatcat cacccacttt aatggaaaat 661 atattaagac accccctgga gtaccagccc catccgatcc cttgctttgc aaatttgctg 721 atggcgggcc aaagaaacga cagaaccaag gaaaatttgt gcaaaatgga cgggcttggc 781 caaggaatgc agacatgggc gtcatggcct tgacctatga ccccaccaca gctcttcaga 841 atgggtttta cccagccccc tataacatca cccccaacag gatgcttgct cagtctgcac 901 tctccccata cctttcctct cctgtgtctt cgtatcagag agtgactcag acatctcctc 961 tacaagtacc taacccatcc tGGATGCACC ACCATTCATA CCTCATGCAG CCTTCAGGTT 1021 CAGTTCTGAC ACCAGGGATG GACCATCCCA TTTCTCTCCA GCCTGCCTCC ATGATGGGAC 1081 CCCTTACCCA GCAACTGGGC CATCTCTCCC TCAGCAGCAC AGGCACGTAT ATGCCGACGG 1141 CTGCAGCTAT GCAAGGAGCT TACATCTCCC AGTACACCCC TGTGCCTTCT TCCAGTGTTT 1201 CAGTCGAGGA GAGCAGCGGC CAACAGAACC AAGTGGCAGT GGACGCACCC TCAGAGCATG 1261 GGGTCTATTC TTTCCAGTTC AACAAGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 1321 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1381 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATAGTCCCA 1441 GCCGATTTAA ATTCGTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1501 aagatt