Transcript: Human XM_017019889.1

PREDICTED: Homo sapiens SRY-box transcription factor 5 (SOX5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SOX5 (6660)
Length:
7427
CDS:
329..2707

Additional Resources:

NCBI RefSeq record:
XM_017019889.1
NBCI Gene record:
SOX5 (6660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018297 CCACTGAACCTATCAGCTAAA pLKO.1 1595 CDS 100% 10.800 15.120 N SOX5 n/a
2 TRCN0000018293 GCACTTCAAATGACAACTTAA pLKO.1 3802 3UTR 100% 13.200 9.240 N SOX5 n/a
3 TRCN0000018296 GCCATTAATGATTCCCGTATT pLKO.1 1243 CDS 100% 10.800 7.560 N SOX5 n/a
4 TRCN0000018295 CCATGCAATGATGGATTTCAA pLKO.1 1972 CDS 100% 5.625 3.938 N SOX5 n/a
5 TRCN0000018294 CCACATATCAAAGAAGAGATA pLKO.1 2573 CDS 100% 4.950 3.465 N SOX5 n/a
6 TRCN0000075495 GCAGTTAAACAGAATGAAGAA pLKO.1 1940 CDS 100% 4.950 3.465 N Sox5 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6107 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11149 pDONR223 100% 73.3% 73.3% None 1_231del;357_358ins105;1249_1572del n/a
2 ccsbBroad304_11149 pLX_304 0% 73.3% 73.3% V5 1_231del;357_358ins105;1249_1572del n/a
3 TRCN0000471554 TAGAGCTACCAGGTATCCCGCGCG pLX_317 21.5% 73.3% 73.3% V5 1_231del;357_358ins105;1249_1572del n/a
Download CSV