Transcript: Human XM_017020302.1

PREDICTED: Homo sapiens glypican 6 (GPC6), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPC6 (10082)
Length:
5481
CDS:
323..1297

Additional Resources:

NCBI RefSeq record:
XM_017020302.1
NBCI Gene record:
GPC6 (10082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123098 ACCCGATAGATGTCAAGATTT pLKO.1 567 CDS 100% 13.200 18.480 N GPC6 n/a
2 TRCN0000441093 CACGTTTCAGGCCCTACAATC pLKO_005 714 CDS 100% 10.800 15.120 N GPC6 n/a
3 TRCN0000123097 GCACAGCAAAGCCAGATACTT pLKO.1 904 CDS 100% 5.625 4.500 N GPC6 n/a
4 TRCN0000432483 TTCATCAGACAGCAGATTATG pLKO_005 1004 CDS 100% 13.200 9.240 N GPC6 n/a
5 TRCN0000109654 CTCCGTGTGATGACCAACAAA pLKO.1 1028 CDS 100% 5.625 3.938 N Gpc6 n/a
6 TRCN0000123095 GCCATTATGAACATGCAAGAA pLKO.1 593 CDS 100% 4.950 3.465 N GPC6 n/a
7 TRCN0000123094 GCTTCCTCTTTCCTTCAGCTA pLKO.1 1482 3UTR 100% 2.640 1.848 N GPC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02305 pDONR223 100% 54.1% 49.8% None (many diffs) n/a
2 ccsbBroad304_02305 pLX_304 0% 54.1% 49.8% V5 (many diffs) n/a
3 TRCN0000481572 GTGAACGCAATAACATTAGTACCT pLX_317 27.8% 54.1% 49.8% V5 (many diffs) n/a
Download CSV