Transcript: Human XM_017020326.1

PREDICTED: Homo sapiens NEDD4 binding protein 2 like 2 (N4BP2L2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
N4BP2L2 (10443)
Length:
3620
CDS:
24..3605

Additional Resources:

NCBI RefSeq record:
XM_017020326.1
NBCI Gene record:
N4BP2L2 (10443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434633 GCGGAAACTTCATGCTTATTT pLKO_005 2250 CDS 100% 15.000 21.000 N N4BP2L2 n/a
2 TRCN0000168395 GTTCCCTTGAGCTACCATTAT pLKO.1 3382 CDS 100% 13.200 18.480 N N4BP2L2 n/a
3 TRCN0000141115 CCATCAAGATGGGTACAGGTA pLKO.1 1340 CDS 100% 2.640 3.696 N N4BP2L2 n/a
4 TRCN0000436689 CAGACAAGAGTAGGTAATAAA pLKO_005 3177 CDS 100% 15.000 10.500 N N4BP2L2 n/a
5 TRCN0000167476 GCAGGACCTCATAAGTTTATA pLKO.1 2478 CDS 100% 15.000 10.500 N N4BP2L2 n/a
6 TRCN0000168827 CCTCTCTAAGGAAGGTGATAA pLKO.1 2066 CDS 100% 13.200 9.240 N N4BP2L2 n/a
7 TRCN0000428038 GCTTACCTCAACCGGATATAC pLKO_005 2713 CDS 100% 13.200 9.240 N N4BP2L2 n/a
8 TRCN0000415210 GTTTGCCTTTCAATTAGTAAA pLKO_005 3410 CDS 100% 13.200 9.240 N N4BP2L2 n/a
9 TRCN0000143431 GCTCAGATGTTGGATCGTTAT pLKO.1 1608 CDS 100% 10.800 7.560 N N4BP2L2 n/a
10 TRCN0000167113 CCAGAAATATTGACAGACAAA pLKO.1 2613 CDS 100% 4.950 3.465 N N4BP2L2 n/a
11 TRCN0000167216 CCATCAACATGGAATCAGAAT pLKO.1 2324 CDS 100% 4.950 3.465 N N4BP2L2 n/a
12 TRCN0000143622 GCCAGACAAATATCCCTGTAA pLKO.1 749 CDS 100% 4.950 3.465 N N4BP2L2 n/a
13 TRCN0000168454 GCCATCAACATGGAATCAGAA pLKO.1 2323 CDS 100% 4.950 3.465 N N4BP2L2 n/a
14 TRCN0000142804 CCTAGAGAAGAAGTAACGAGT pLKO.1 60 CDS 100% 2.640 1.848 N N4BP2L2 n/a
15 TRCN0000145053 CTCAGGAACAATTTGTTCCAT pLKO.1 619 CDS 100% 0.300 0.210 N N4BP2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02435 pDONR223 100% 48.2% 47.3% None (many diffs) n/a
2 ccsbBroad304_02435 pLX_304 0% 48.2% 47.3% V5 (many diffs) n/a
3 TRCN0000475837 AAATCACTCTTTCATCCATTGCCA pLX_317 16.1% 48.2% 47.3% V5 (many diffs) n/a
Download CSV