Transcript: Human XM_017020366.2

PREDICTED: Homo sapiens SGT1 homolog, MIS12 kinetochore complex assembly cochaperone (SUGT1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUGT1 (10910)
Length:
14224
CDS:
374..1303

Additional Resources:

NCBI RefSeq record:
XM_017020366.2
NBCI Gene record:
SUGT1 (10910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007614 GCTCTCATCGTATTGTGTATA pLKO.1 1316 3UTR 100% 13.200 18.480 N SUGT1 n/a
2 TRCN0000007616 GCACGTTTAAAGTACTTTCAA pLKO.1 903 CDS 100% 5.625 7.875 N SUGT1 n/a
3 TRCN0000314947 CCAGAACAGAGCACGTTTAAA pLKO_005 893 CDS 100% 15.000 10.500 N SUGT1 n/a
4 TRCN0000315017 GGAACTTCTTCATCCTATAAT pLKO_005 871 CDS 100% 15.000 10.500 N SUGT1 n/a
5 TRCN0000315018 CAGAATCTCAAGTAGTCATTA pLKO_005 741 CDS 100% 13.200 9.240 N SUGT1 n/a
6 TRCN0000007617 GCAGATGTAAAGAACCTATAT pLKO.1 1016 CDS 100% 13.200 9.240 N SUGT1 n/a
7 TRCN0000007615 CCTGATGATATGGAATGGAAA pLKO.1 1274 CDS 100% 4.950 3.465 N SUGT1 n/a
8 TRCN0000315019 ATTGTGTATATTCACCTAATG pLKO_005 1327 3UTR 100% 10.800 6.480 N SUGT1 n/a
9 TRCN0000007618 GCTGATGCAAAGAAGTCTCTA pLKO.1 401 CDS 100% 4.950 2.475 Y SUGT1 n/a
10 TRCN0000314945 GCTGATGCAAAGAAGTCTCTA pLKO_005 401 CDS 100% 4.950 2.475 Y SUGT1 n/a
11 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 10727 3UTR 100% 1.080 0.540 Y GPR83 n/a
12 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 10727 3UTR 100% 1.080 0.540 Y MYORG n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 609 CDS 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3249 3UTR 100% 4.950 2.475 Y LOC339059 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 8281 3UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 609 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020366.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10391 pDONR223 100% 22.1% 16.8% None (many diffs) n/a
2 ccsbBroad304_10391 pLX_304 0% 22.1% 16.8% V5 (many diffs) n/a
3 TRCN0000465273 ACGGAGATAGTGCAGGTACTCAAA pLX_317 100% 22.1% 16.8% V5 (many diffs) n/a
Download CSV