Transcript: Human XM_017021470.1

PREDICTED: Homo sapiens proteasome 26S subunit, ATPase 1 (PSMC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSMC1 (5700)
Length:
3108
CDS:
1787..2890

Additional Resources:

NCBI RefSeq record:
XM_017021470.1
NBCI Gene record:
PSMC1 (5700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050504 GCACCGTCCATCGTGTTTATT pLKO.1 2399 CDS 100% 15.000 21.000 N PSMC1 n/a
2 TRCN0000323178 CAGGAGACCTATGCAGATATT pLKO_005 2108 CDS 100% 13.200 18.480 N PSMC1 n/a
3 TRCN0000323180 TCACACTCAGTGCCGGTTAAA pLKO_005 1729 5UTR 100% 13.200 18.480 N PSMC1 n/a
4 TRCN0000323176 TTATGAAGAGATGGGTATAAA pLKO_005 2197 CDS 100% 15.000 12.000 N PSMC1 n/a
5 TRCN0000050507 GAACACTACGTCAGCATTCTT pLKO.1 1955 CDS 100% 5.625 4.500 N PSMC1 n/a
6 TRCN0000050503 CCAAAGCAGTAGCAAACCAAA pLKO.1 2274 CDS 100% 4.950 3.960 N PSMC1 n/a
7 TRCN0000323177 TGCACCGTCCATCGTGTTTAT pLKO_005 2398 CDS 100% 13.200 9.240 N PSMC1 n/a
8 TRCN0000323179 AGATTTCTCAATCCCTGAAAG pLKO_005 2924 3UTR 100% 10.800 7.560 N PSMC1 n/a
9 TRCN0000328670 ATCATGGCCACAAACCGAATA pLKO_005 2549 CDS 100% 10.800 7.560 N Psmc1 n/a
10 TRCN0000328671 GAACCTTGGAAGAGATCATTG pLKO_005 1896 CDS 100% 10.800 7.560 N Psmc1 n/a
11 TRCN0000087018 ACCAGTTGGATGGATTTGATT pLKO.1 2508 CDS 100% 5.625 3.938 N EG386042 n/a
12 TRCN0000050506 GTCACAGTGATGAAGGTAGAA pLKO.1 2078 CDS 100% 4.950 3.465 N PSMC1 n/a
13 TRCN0000050505 GAACTTATTCAGAAGTACCTA pLKO.1 2327 CDS 100% 3.000 2.100 N PSMC1 n/a
14 TRCN0000087020 GAAACTTTGGATCCAGCACTT pLKO.1 2570 CDS 100% 4.050 2.430 N EG386042 n/a
15 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1253 5UTR 100% 1.080 0.540 Y GPR83 n/a
16 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1253 5UTR 100% 1.080 0.540 Y MYORG n/a
17 TRCN0000086682 GCCAGCAAACTGCCACTGGTA pLKO.1 1703 5UTR 100% 0.880 0.616 N LOC328691 n/a
18 TRCN0000065566 GCGAACAATGTTGGAACTGTT pLKO.1 2485 CDS 100% 4.950 2.970 N Psmc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06803 pDONR223 100% 83.3% 83.4% None 0_1ins219;126C>T n/a
2 ccsbBroad304_06803 pLX_304 0% 83.3% 83.4% V5 0_1ins219;126C>T n/a
3 TRCN0000474360 CTCAGACGGATCAGCGACCGCTAA pLX_317 38.8% 83.3% 83.4% V5 0_1ins219;126C>T n/a
4 ccsbBroadEn_15547 pDONR223 0% 83.2% 83.4% None 0_1ins219;126C>T;873C>A n/a
5 ccsbBroad304_15547 pLX_304 0% 83.2% 83.4% V5 0_1ins219;126C>T;873C>A n/a
6 TRCN0000470475 TCATAGGACCATTTCTTAGCCTGA pLX_317 28.6% 83.2% 83.4% V5 0_1ins219;126C>T;873C>A n/a
7 ccsbBroadEn_06802 pDONR223 100% 83.2% 83.1% None 0_1ins219;126C>T;140A>G n/a
8 ccsbBroad304_06802 pLX_304 0% 83.2% 83.1% V5 0_1ins219;126C>T;140A>G n/a
9 TRCN0000465796 ATACCGATCTTGGGCTGATGTGGC pLX_317 32% 83.2% 83.1% V5 0_1ins219;126C>T;140A>G n/a
Download CSV