Transcript: Human XM_017021697.2

PREDICTED: Homo sapiens synaptotagmin 16 (SYT16), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYT16 (83851)
Length:
13353
CDS:
72..1376

Additional Resources:

NCBI RefSeq record:
XM_017021697.2
NBCI Gene record:
SYT16 (83851)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314674 TTTCCGAAACCTCGCTGTTAA pLKO_005 1334 CDS 100% 13.200 18.480 N SYT16 n/a
2 TRCN0000314742 GTTACTATTTGCAACCATTTA pLKO_005 1874 3UTR 100% 13.200 9.240 N SYT16 n/a
3 TRCN0000001757 CAGACAGGATTGGAGCAGAAA pLKO.1 393 CDS 100% 4.950 3.465 N SYT16 n/a
4 TRCN0000001759 GAGAGAATGATGGGAGAGAAA pLKO.1 1077 CDS 100% 4.950 3.465 N SYT16 n/a
5 TRCN0000314741 GAGAGAATGATGGGAGAGAAA pLKO_005 1077 CDS 100% 4.950 3.465 N SYT16 n/a
6 TRCN0000001758 GAGGAGATGAAGGAAACCAAA pLKO.1 1448 3UTR 100% 4.950 3.465 N SYT16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021697.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09117 pDONR223 100% 62.6% 55.6% None (many diffs) n/a
2 ccsbBroad304_09117 pLX_304 0% 62.6% 55.6% V5 (many diffs) n/a
3 TRCN0000465420 AATATCTCAGCGAGGGGATTAATA pLX_317 16.5% 62.6% 55.6% V5 (many diffs) n/a
4 ccsbBroadEn_12755 pDONR223 100% 18.8% 18.5% None (many diffs) n/a
5 ccsbBroad304_12755 pLX_304 0% 18.8% 18.5% V5 (many diffs) n/a
6 TRCN0000479179 GACCTTACCGCCTCTGTGCTATGT pLX_317 77.2% 18.8% 18.5% V5 (many diffs) n/a
Download CSV