Transcript: Human XM_017021914.1

PREDICTED: Homo sapiens leucine rich repeat containing 28 (LRRC28), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC28 (123355)
Length:
5577
CDS:
525..1268

Additional Resources:

NCBI RefSeq record:
XM_017021914.1
NBCI Gene record:
LRRC28 (123355)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432959 ACCTCACTGTGGACCGAAATC pLKO_005 1006 CDS 100% 10.800 15.120 N LRRC28 n/a
2 TRCN0000424396 ACTATACCTGCACTCAAATAA pLKO_005 731 CDS 100% 15.000 12.000 N LRRC28 n/a
3 TRCN0000423131 CCATCTTATCTGTACAATAAA pLKO_005 1182 CDS 100% 15.000 10.500 N LRRC28 n/a
4 TRCN0000434516 ACCAATCGTTTGCTAACTTTA pLKO_005 951 CDS 100% 13.200 9.240 N LRRC28 n/a
5 TRCN0000434786 ACTCCAATGTCTGGATCTTAG pLKO_005 791 CDS 100% 10.800 7.560 N LRRC28 n/a
6 TRCN0000005130 GCTTTACGTCATCTTCGATTA pLKO.1 858 CDS 100% 10.800 7.560 N LRRC28 n/a
7 TRCN0000010924 GATAACAACATTCACCTGAAA pLKO.1 1155 CDS 100% 4.950 3.465 N LRRC28 n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4697 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04772 pDONR223 100% 66.5% 64.3% None (many diffs) n/a
2 ccsbBroad304_04772 pLX_304 0% 66.5% 64.3% V5 (many diffs) n/a
3 TRCN0000466194 TCCCGTCAACCGGTGAGCTGGTCA pLX_317 35.2% 66.5% 64.3% V5 (many diffs) n/a
4 ccsbBroadEn_13098 pDONR223 100% 33.7% 30% None (many diffs) n/a
5 ccsbBroad304_13098 pLX_304 0% 33.7% 30% V5 (many diffs) n/a
6 TRCN0000468959 TCCTAGGGACCACCATATTTTTAG pLX_317 100% 33.7% 30% V5 (many diffs) n/a
Download CSV