Construct: ORF TRCN0000466194
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010671.1_s317c1
- Derived from:
- ccsbBroadEn_04772
- DNA Barcode:
- TCCCGTCAACCGGTGAGCTGGTCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRC28 (123355)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466194
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001321675.2 | 100% | 100% | |
2 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_144598.5 | 100% | 100% | |
3 | human | 123355 | LRRC28 | leucine rich repeat contain... | XM_011521218.2 | 100% | 100% | |
4 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001321676.2 | 94.9% | 90.6% | (many diffs) |
5 | human | 123355 | LRRC28 | leucine rich repeat contain... | XM_011521220.2 | 93.4% | 93.4% | 1029_1030ins72 |
6 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001284400.3 | 85% | 80.4% | 870_871ins160;936_937insTGAGT |
7 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001321677.2 | 81.1% | 81.1% | 384_385ins207 |
8 | human | 123355 | LRRC28 | leucine rich repeat contain... | XR_001751086.2 | 72.3% | 1_153del;848_916del;1324_1522del | |
9 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001321678.2 | 71.2% | 65.5% | (many diffs) |
10 | human | 123355 | LRRC28 | leucine rich repeat contain... | XM_011521221.3 | 70.2% | 66.7% | (many diffs) |
11 | human | 123355 | LRRC28 | leucine rich repeat contain... | XM_006720389.4 | 66.5% | 64.3% | (many diffs) |
12 | human | 123355 | LRRC28 | leucine rich repeat contain... | XM_017021914.1 | 66.5% | 64.3% | (many diffs) |
13 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001321679.2 | 58% | 58% | 0_1ins462 |
14 | human | 123355 | LRRC28 | leucine rich repeat contain... | NM_001321680.2 | 58% | 58% | 0_1ins462 |
15 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135758.2 | 17.9% | (many diffs) | |
16 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135753.2 | 17.1% | 1_121del;503_504ins95;1128_5757del | |
17 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135757.2 | 16.9% | (many diffs) | |
18 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135756.2 | 16.4% | (many diffs) | |
19 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135754.2 | 15.8% | (many diffs) | |
20 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135755.2 | 15.3% | (many diffs) | |
21 | human | 123355 | LRRC28 | leucine rich repeat contain... | NR_135759.2 | 13.5% | (many diffs) | |
22 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | NM_175124.5 | 88% | 89.9% | (many diffs) |
23 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | XM_006541130.3 | 70.3% | 73.2% | (many diffs) |
24 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | XM_006541133.2 | 59.1% | 55.4% | (many diffs) |
25 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | NM_027413.1 | 36.5% | 36.5% | (many diffs) |
26 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | NR_028143.1 | 29.5% | (many diffs) | |
27 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | NR_028144.1 | 28.1% | (many diffs) | |
28 | mouse | 67867 | Lrrc28 | leucine rich repeat contain... | XR_391360.3 | 27.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1167
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtccgaactt tgtaagacga tctctgtggc aaggctagaa aagcacaaga 121 atttgttctt aaattatagg aatctgcacc attttccatt ggagttactg aaagatgagg 181 gactgcagta cttggagaga ctctatatga aaaggaactc cctgacatcc ttgccagaaa 241 accttgctca gaagcttcca aaccttgtgg aactatacct gcactcaaat aacatagttg 301 tggttccgga agccattggg tctcttgtaa aactccaatg tctggatctt agtgacaatg 361 ccttagaaat tgtttgccca gaaattggtc gtctgagagc tttacgtcat cttcgattag 421 ctaataacca actgcaattc ctacctccag aggttggcga tttgaaggag ctgcagacac 481 tagacatttc taccaatcgt ttgctaactt tacccgagag gcttcacatg tgcctttctc 541 tgcagtacct cactgtggac cgaaatcgtc tatggtatgt gccgcgccat ctctgccagc 601 tgcccagcct caatgagctc tccatggctg gaaaccgtct tgcatttttg ccacttgatt 661 taggtcgatc tcgagaacta cagtatgtat acgtggataa caacattcac ctgaaaggct 721 tgccatctta tctgtacaat aaagtcatcg ggtgcagtgg ctgtggtgct cccattcaag 781 ttTCCGAGGT GAAGCTGCTT TCCTTTTCAT CAGGGCAGCG AACCGTTTTC CTCCCAGCTG 841 AGGTGAAGGC CATAGGGACG GAGCATGATC ACGTCCTCCC TCTGCAGGAA TTGGCTATGA 901 GAGGGCTGTA TCATACCTAC CACAGCTTGC TGAAAGATTT GAACTTTCTG TCTCCAATCT 961 CATTACCCAG AAGTCTCCTA GAGCTGCTGC ACTGCCCTCT GGGGCACTGT CATCGGTGTA 1021 GTGAGCCTAT GTTTACCATC GTCTACCCCA AGCTCTTTCC CTTGAGAGAG ACGCCAATGG 1081 CAGGGCTGCA CCAGTGGAAG ACAACTGTTA GTTTTGTGGC TTACTGCTGC TCCACCCAGT 1141 GTCTGCAGAC TTTTGACCTG CTGAGTTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1201 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1261 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATCCCGTCA 1321 ACCGGTGAGC TGGTCAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1381 aagatt