Transcript: Human XM_017022826.2

PREDICTED: Homo sapiens nuclear pore complex interacting protein family member B9 (NPIPB9), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPIPB9 (100507607)
Length:
1676
CDS:
387..1595

Additional Resources:

NCBI RefSeq record:
XM_017022826.2
NBCI Gene record:
NPIPB9 (100507607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139541 CCACCCTCAGTGGATGATAAT pLKO.1 1173 CDS 100% 13.200 6.600 Y NPIPB15 n/a
2 TRCN0000256804 TTGGCCTGAAAGACGTCATTA pLKO_005 613 CDS 100% 13.200 6.600 Y NPIPB3 n/a
3 TRCN0000284749 TGGCCTGAAAGACGTCATTAC pLKO_005 614 CDS 100% 10.800 5.400 Y NPIPB5 n/a
4 TRCN0000141615 CCTCCAACTCAACAACATTCT pLKO.1 1095 CDS 100% 4.950 2.475 Y NPIPA1 n/a
5 TRCN0000152162 CTGAAAGACGTCATTACTCTA pLKO.1 618 CDS 100% 4.950 2.475 Y NPIPB7 n/a
6 TRCN0000141507 CTTCTGCAAGAAAGCCTCTTT pLKO.1 817 CDS 100% 4.950 2.475 Y NPIPB15 n/a
7 TRCN0000141710 GAGGACTACCACAAATGCAAA pLKO.1 789 CDS 100% 4.950 2.475 Y NPIPB15 n/a
8 TRCN0000140729 GCTGGGATTTATCAGCCATCA pLKO.1 422 CDS 100% 4.050 2.025 Y NPIPB15 n/a
9 TRCN0000141673 CCTCAGTGGATGATAATCTCA pLKO.1 1366 CDS 100% 3.000 1.500 Y NPIPB15 n/a
10 TRCN0000141237 CCTCAGTGGATGATAATCTGA pLKO.1 1240 CDS 100% 3.000 1.500 Y NPIPB15 n/a
11 TRCN0000140069 GTCATTACTCTACGGAGGCAT pLKO.1 627 CDS 100% 2.640 1.320 Y NPIPB15 n/a
12 TRCN0000154791 GTCATTACTCTACGGAGGCAT pLKO.1 627 CDS 100% 2.640 1.320 Y NPIPB7 n/a
13 TRCN0000140776 GAATGTCTCTTTGTCCCGCTT pLKO.1 1263 CDS 100% 2.160 1.080 Y NPIPB15 n/a
14 TRCN0000150531 GTTTCTTCCTTTCGAGGAAAT pLKO.1 588 CDS 100% 1.080 0.540 Y NPIPB7 n/a
15 TRCN0000145269 GTCTTTCCTGAAGACTATCTT pLKO.1 455 CDS 100% 0.563 0.281 Y NPIPB15 n/a
16 TRCN0000144748 GTCCATTTGTATGCACACAAA pLKO.1 560 CDS 100% 0.495 0.248 Y NPIPB15 n/a
17 TRCN0000139444 CCTGTGTCTTTCCTGAAGACT pLKO.1 450 CDS 100% 0.300 0.150 Y NPIPB15 n/a
18 TRCN0000156135 CCTGTGTCTTTCCTGAAGACT pLKO.1 450 CDS 100% 0.300 0.150 Y NPIPB7 n/a
19 TRCN0000264026 TACCTCACAGCTGAAACTTTA pLKO_005 1047 CDS 100% 0.000 0.000 Y PKD1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022826.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13743 pDONR223 100% 68.5% 66% None (many diffs) n/a
2 ccsbBroad304_13743 pLX_304 0% 68.5% 66% V5 (many diffs) n/a
3 TRCN0000477724 CCAAAATCCTACACAGGAGGTGAC pLX_317 25.2% 68.5% 66% V5 (many diffs) n/a
4 ccsbBroadEn_15304 pDONR223 57.8% 29.8% 26.7% None (many diffs) n/a
5 ccsbBroad304_15304 pLX_304 0% 29.8% 26.7% V5 (many diffs) n/a
6 TRCN0000465408 CACCCATAGAAGAATTACCGCCGA pLX_317 100% 15.8% 14.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV