Construct: ORF TRCN0000465408
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006321.1_s317c1
- Derived from:
- ccsbBroadEn_15304
- DNA Barcode:
- CACCCATAGAAGAATTACCGCCGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PKD1P1 (339044)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465408
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450429.1 | 33.1% | 31.1% | (many diffs) |
| 2 | human | 729978 | NPIPB2 | nuclear pore complex intera... | NM_001355514.1 | 29.5% | 27.8% | (many diffs) |
| 3 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450428.1 | 29.5% | 27.8% | (many diffs) |
| 4 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450431.1 | 29.5% | 27.8% | (many diffs) |
| 5 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022836.2 | 27.6% | 27.2% | 1_279del;482C>A;485_738del |
| 6 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022840.2 | 27.6% | 27.2% | 1_279del;482C>A;485_738del |
| 7 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_017030214.2 | 27.3% | 26.4% | (many diffs) |
| 8 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_005255743.3 | 24.8% | 22.6% | (many diffs) |
| 9 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_011523501.2 | 24.2% | 21.9% | (many diffs) |
| 10 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022827.2 | 20.4% | 18.5% | (many diffs) |
| 11 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450424.1 | 20.3% | 19% | (many diffs) |
| 12 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450425.1 | 20.3% | 19% | (many diffs) |
| 13 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450426.1 | 20.3% | 19% | (many diffs) |
| 14 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | NM_001277325.2 | 19.2% | 18.5% | (many diffs) |
| 15 | human | 9284 | NPIPA1 | nuclear pore complex intera... | NM_006985.4 | 19.1% | 18.5% | (many diffs) |
| 16 | human | 642778 | NPIPA3 | nuclear pore complex intera... | NM_001277323.1 | 18.9% | 18.2% | (many diffs) |
| 17 | human | 642799 | NPIPA2 | nuclear pore complex intera... | NM_001277324.1 | 18.9% | 18.2% | (many diffs) |
| 18 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522580.2 | 18.7% | 18% | (many diffs) |
| 19 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450388.1 | 18.7% | 18% | (many diffs) |
| 20 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450387.1 | 18.6% | 17.6% | (many diffs) |
| 21 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | NM_001282507.1 | 18.4% | 18.1% | 1_648del;851C>A;854_1107del |
| 22 | human | 101059953 | NPIPA8 | nuclear pore complex intera... | NM_001282511.2 | 18.4% | 18.1% | 1_648del;851C>A;854_1107del |
| 23 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022834.1 | 18.4% | 18.1% | 1_648del;851C>A;854_1107del |
| 24 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022835.1 | 18.4% | 18.1% | 1_648del;851C>A;854_1107del |
| 25 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_017023631.2 | 18.4% | 16.7% | (many diffs) |
| 26 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | XM_024450132.1 | 18.2% | 17.6% | (many diffs) |
| 27 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_024452519.1 | 18.2% | 17.6% | (many diffs) |
| 28 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_011522339.3 | 18.2% | 17.9% | 1_660del;863C>A;866_1119del |
| 29 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450418.1 | 18% | 16.4% | (many diffs) |
| 30 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_017023554.1 | 17.9% | 17.3% | (many diffs) |
| 31 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_024450379.1 | 17.9% | 17.3% | (many diffs) |
| 32 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450385.1 | 17.9% | 17.3% | (many diffs) |
| 33 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450386.1 | 17.9% | 17.3% | (many diffs) |
| 34 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022833.2 | 17.8% | 17.5% | 1_684del;887C>A;890_1143del |
| 35 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522578.2 | 17.5% | 16.9% | (many diffs) |
| 36 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450384.1 | 17.5% | 16.9% | (many diffs) |
| 37 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_005255735.5 | 17.1% | 16.9% | 1_729del;932C>A;935_1188del |
| 38 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_017030211.2 | 17% | 16.4% | (many diffs) |
| 39 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522576.2 | 16.6% | 16% | (many diffs) |
| 40 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522577.2 | 16.6% | 16% | (many diffs) |
| 41 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_017023553.1 | 16.6% | 16% | (many diffs) |
| 42 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450381.1 | 16.6% | 16% | (many diffs) |
| 43 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450382.1 | 16.6% | 16% | (many diffs) |
| 44 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450383.1 | 16.6% | 16% | (many diffs) |
| 45 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_024450290.1 | 16.4% | 14.9% | (many diffs) |
| 46 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_011545931.2 | 16.1% | 14.7% | (many diffs) |
| 47 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450417.1 | 15.8% | 14.4% | (many diffs) |
| 48 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022826.2 | 15.8% | 14.4% | (many diffs) |
| 49 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_005255741.4 | 15.6% | 14.2% | (many diffs) |
| 50 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_017023630.1 | 15.6% | 14.2% | (many diffs) |
| 51 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_024450419.1 | 15.6% | 14.2% | (many diffs) |
| 52 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022825.2 | 15.3% | 14% | (many diffs) |
| 53 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023626.1 | 15.3% | 14% | (many diffs) |
| 54 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450416.1 | 15.3% | 14% | (many diffs) |
| 55 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_017023628.1 | 15% | 13.7% | (many diffs) |
| 56 | human | 728741 | NPIPB6 | nuclear pore complex intera... | NM_001282524.1 | 14.9% | 13.6% | (many diffs) |
| 57 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_011545929.2 | 14.9% | 13.6% | (many diffs) |
| 58 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | NM_001287251.1 | 14.8% | 13.5% | (many diffs) |
| 59 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022824.2 | 14.8% | 13.5% | (many diffs) |
| 60 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023625.1 | 14.8% | 13.5% | (many diffs) |
| 61 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | NM_001287250.1 | 14.7% | 13.4% | (many diffs) |
| 62 | human | 728734 | NPIPB8 | nuclear pore complex intera... | NM_001310136.1 | 14.7% | 13.4% | (many diffs) |
| 63 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_003118719.8 | 14.7% | 13.4% | (many diffs) |
| 64 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023624.1 | 14.7% | 13.4% | (many diffs) |
| 65 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450415.1 | 14.7% | 13.4% | (many diffs) |
| 66 | human | 440348 | NPIPB15 | nuclear pore complex intera... | NM_001306094.1 | 14.2% | 12.8% | (many diffs) |
| 67 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_011523498.3 | 14.2% | 12.8% | (many diffs) |
| 68 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_017023248.1 | 14.2% | 12.8% | (many diffs) |
| 69 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022823.2 | 14.1% | 12.8% | (many diffs) |
| 70 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023623.1 | 13.8% | 12.6% | (many diffs) |
| 71 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_011545693.3 | 13.8% | 12.5% | (many diffs) |
| 72 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022820.2 | 13.7% | 12.5% | (many diffs) |
| 73 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022821.2 | 13.7% | 12.5% | (many diffs) |
| 74 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022822.2 | 13.7% | 12.5% | (many diffs) |
| 75 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_011523496.2 | 13.7% | 12.4% | (many diffs) |
| 76 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022819.2 | 13.3% | 12.1% | (many diffs) |
| 77 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022818.2 | 13.2% | 12.1% | (many diffs) |
| 78 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022817.2 | 13.2% | 12% | (many diffs) |
| 79 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023622.1 | 13.2% | 12% | (many diffs) |
| 80 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_011545690.3 | 13.1% | 11.9% | (many diffs) |
| 81 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022816.2 | 13% | 11.8% | (many diffs) |
| 82 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022814.2 | 12.4% | 11.3% | (many diffs) |
| 83 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022815.2 | 12.4% | 11.3% | (many diffs) |
| 84 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XR_001756353.1 | 10% | 1_847del;953_954ins99 | |
| 85 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XR_001756354.2 | 7.3% | (many diffs) | |
| 86 | human | 440353 | NPIPB12 | nuclear pore complex intera... | NM_001355401.1 | 7.1% | 6.7% | (many diffs) |
| 87 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450289.1 | 7% | 6.6% | (many diffs) |
| 88 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450287.1 | 6.3% | 5.9% | (many diffs) |
| 89 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450288.1 | 6.3% | 5.9% | (many diffs) |
| 90 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450286.1 | 6.2% | 5.9% | (many diffs) |
| 91 | human | 613037 | NPIPB13 | nuclear pore complex intera... | NM_001321892.1 | 5.8% | 5.5% | (many diffs) |
| 92 | human | 100132247 | NPIPB5 | nuclear pore complex intera... | NM_001135865.1 | 5.8% | 5.4% | (many diffs) |
| 93 | human | 23117 | NPIPB3 | nuclear pore complex intera... | NM_130464.3 | 5.8% | 5.4% | (many diffs) |
| 94 | human | 728888 | NPIPB11 | nuclear pore complex intera... | NM_001310137.2 | 5.8% | 5.4% | (many diffs) |
| 95 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_017023247.1 | 5.7% | 5.4% | (many diffs) |
| 96 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450285.1 | 5.7% | 5.4% | (many diffs) |
| 97 | human | 728888 | NPIPB11 | nuclear pore complex intera... | XM_024450420.1 | 5.6% | 5.2% | (many diffs) |
| 98 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450284.1 | 5.4% | 5% | (many diffs) |
| 99 | human | 440345 | NPIPB4 | nuclear pore complex intera... | NM_001310148.1 | 5.4% | 5% | (many diffs) |
| 100 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_017023244.2 | 5.4% | 5% | (many diffs) |
| 101 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450283.1 | 5.2% | 4.9% | (many diffs) |
| 102 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | XR_932754.3 | 5.1% | 1_1836del;1942_1943ins99 | |
| 103 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | XR_002957772.1 | 4.9% | 1_1159del;1227_1228ins137 | |
| 104 | human | 283970 | PDXDC2P-NPIPB14P | nuclear pore complex-intera... | NR_003610.1 | 4.4% | (many diffs) | |
| 105 | human | 105369154 | PKD1P6-NPIPP1 | PKD1P6-NPIPP1 readthrough | NR_123721.1 | 3.7% | (many diffs) | |
| 106 | human | 339044 | PKD1P1 | polycystin 1, transient rec... | NR_036447.1 | 3.2% | 1_5784del;5987C>A;5990_6295del | |
| 107 | human | 110006323 | PKD1P4-NPIPA8 | PKD1P4-NPIPA8 readthrough | NR_146336.1 | 2.8% | 1_6591del;6794C>A;6797_7102del | |
| 108 | human | 109951030 | PKD1P3-NPIPA1 | PKD1P3-NPIPA1 readthrough | NR_146231.1 | 2.7% | (many diffs) | |
| 109 | human | 110006322 | PKD1P5-LOC105376752 | PKD1P5-LOC105376752 readthr... | NR_146331.1 | 1.7% | 1_11269del;11472C>A;11475_11747del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 90
- ORF end:
- 297
- ORF length:
- 207
- Sequence:
-
1 TCAGACAGTG GTTCAAAGTT TTTTTCTTCC ATTTCAGGTG TCGTGAGGCT AGCATCGATT 61 GATCAACAAG TTTGTACAAA AAAGTTGGCA TGGCGGCAGT GGAGCATCGT CATTCTTCAG 121 GATTGCCCTA CTGGCCCTAC CTCACAGCTG AAACTTTAAA AAACAGGATG GGCCACCAGC 181 CACCTCCTCC AACTCAACAA CATTCTATAA TTGATAACTC CCTGAGCCTC AAGACACCTT 241 CCGAGTGTGT GCTCTATCCC CTTCCACCCT CAGCGGATGA TAATCTCAAG AAACTACCCA 301 ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC 361 GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT 421 ATATCTTGTG GAAAGGACGA CACCCATAGA AGAATTACCG CCGAACGCGT TAAGTCgaca 481 atcaacctct ggattacaaa atttgtgaaa gatt