Construct: ORF TRCN0000477724
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003382.1_s317c1
- Derived from:
- ccsbBroadEn_13743
- DNA Barcode:
- CCAAAATCCTACACAGGAGGTGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPIPB6 (728741)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477724
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | NM_001287250.1 | 94.7% | 94.2% | (many diffs) |
| 2 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_003118719.8 | 94.7% | 94.2% | (many diffs) |
| 3 | human | 728734 | NPIPB8 | nuclear pore complex intera... | NM_001310136.1 | 94.5% | 94% | (many diffs) |
| 4 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023624.1 | 94.5% | 94% | (many diffs) |
| 5 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450415.1 | 94.5% | 94% | (many diffs) |
| 6 | human | 728741 | NPIPB6 | nuclear pore complex intera... | NM_001282524.1 | 93.1% | 92.7% | (many diffs) |
| 7 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_011545929.2 | 93.1% | 92.7% | (many diffs) |
| 8 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022825.2 | 89.4% | 87.4% | (many diffs) |
| 9 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023626.1 | 89.4% | 87.2% | (many diffs) |
| 10 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450416.1 | 89.4% | 87.2% | (many diffs) |
| 11 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_011545693.3 | 89% | 88.6% | (many diffs) |
| 12 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | NM_001287251.1 | 88.9% | 83.4% | (many diffs) |
| 13 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022824.2 | 88.9% | 83.4% | (many diffs) |
| 14 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023625.1 | 88.8% | 83.2% | (many diffs) |
| 15 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_005255741.4 | 87.8% | 85.7% | (many diffs) |
| 16 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_017023630.1 | 87.8% | 85.7% | (many diffs) |
| 17 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_024450419.1 | 87.8% | 85.7% | (many diffs) |
| 18 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_017023628.1 | 87.3% | 81.7% | (many diffs) |
| 19 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450417.1 | 86.9% | 86.1% | (many diffs) |
| 20 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_011523496.2 | 86.5% | 79.8% | (many diffs) |
| 21 | human | 440348 | NPIPB15 | nuclear pore complex intera... | NM_001306094.1 | 86% | 82.9% | (many diffs) |
| 22 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_011523498.3 | 86% | 82.9% | (many diffs) |
| 23 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_017023248.1 | 86% | 82.9% | (many diffs) |
| 24 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022817.2 | 85.5% | 85.1% | (many diffs) |
| 25 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_011545931.2 | 85.4% | 84.6% | (many diffs) |
| 26 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023622.1 | 85.3% | 84.9% | (many diffs) |
| 27 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_011545690.3 | 84.8% | 84.4% | (many diffs) |
| 28 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022818.2 | 81.3% | 76.1% | (many diffs) |
| 29 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_017023623.1 | 81.2% | 80.7% | (many diffs) |
| 30 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022814.2 | 80.8% | 80.4% | (many diffs) |
| 31 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022815.2 | 80.8% | 80.4% | (many diffs) |
| 32 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022820.2 | 80.8% | 78.9% | (many diffs) |
| 33 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022821.2 | 80.8% | 78.9% | (many diffs) |
| 34 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022822.2 | 80.8% | 78.9% | (many diffs) |
| 35 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022819.2 | 80.4% | 75.6% | (many diffs) |
| 36 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022823.2 | 78.5% | 77.9% | (many diffs) |
| 37 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022816.2 | 76.9% | 76.5% | (many diffs) |
| 38 | human | 728734 | NPIPB8 | nuclear pore complex intera... | XM_024450418.1 | 75.9% | 73% | (many diffs) |
| 39 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_017023631.2 | 74.3% | 71.3% | (many diffs) |
| 40 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_024450290.1 | 73.4% | 69.8% | (many diffs) |
| 41 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022826.2 | 68.5% | 66% | (many diffs) |
| 42 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | XM_024450132.1 | 58.8% | 51.4% | (many diffs) |
| 43 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_017023554.1 | 58.6% | 51.3% | (many diffs) |
| 44 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_024450379.1 | 58.6% | 51.3% | (many diffs) |
| 45 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450385.1 | 58.5% | 51.1% | (many diffs) |
| 46 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450386.1 | 58.5% | 51.1% | (many diffs) |
| 47 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022833.2 | 57.1% | 45.2% | (many diffs) |
| 48 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_011522339.3 | 57% | 47.2% | (many diffs) |
| 49 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_005255735.5 | 57% | 45.3% | (many diffs) |
| 50 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_017030211.2 | 56.9% | 45.7% | (many diffs) |
| 51 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_005255742.4 | 55.6% | 53.8% | (many diffs) |
| 52 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522576.2 | 55.4% | 48.4% | (many diffs) |
| 53 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522577.2 | 55.4% | 48.4% | (many diffs) |
| 54 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_017023553.1 | 55.4% | 48.4% | (many diffs) |
| 55 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | NM_001282507.1 | 55.3% | 45.1% | (many diffs) |
| 56 | human | 101059953 | NPIPA8 | nuclear pore complex intera... | NM_001282511.2 | 55.3% | 45.1% | (many diffs) |
| 57 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022834.1 | 55.3% | 45.1% | (many diffs) |
| 58 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022835.1 | 55.3% | 45.1% | (many diffs) |
| 59 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450381.1 | 55.3% | 48.2% | (many diffs) |
| 60 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450382.1 | 55.3% | 48.2% | (many diffs) |
| 61 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450383.1 | 55.3% | 48.2% | (many diffs) |
| 62 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_024452519.1 | 55.1% | 45.5% | (many diffs) |
| 63 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522578.2 | 54.6% | 43.7% | (many diffs) |
| 64 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450384.1 | 54.5% | 43.5% | (many diffs) |
| 65 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522580.2 | 54.4% | 45.4% | (many diffs) |
| 66 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450388.1 | 54.4% | 45.2% | (many diffs) |
| 67 | human | 728741 | NPIPB6 | nuclear pore complex intera... | XM_005255743.3 | 54.2% | 50.6% | (many diffs) |
| 68 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450424.1 | 53.9% | 52.9% | (many diffs) |
| 69 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450425.1 | 53.9% | 52.9% | (many diffs) |
| 70 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450426.1 | 53.9% | 52.9% | (many diffs) |
| 71 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | NM_001277325.2 | 52.8% | 43.4% | (many diffs) |
| 72 | human | 642778 | NPIPA3 | nuclear pore complex intera... | NM_001277323.1 | 52.6% | 43.4% | (many diffs) |
| 73 | human | 642799 | NPIPA2 | nuclear pore complex intera... | NM_001277324.1 | 52.6% | 43.2% | (many diffs) |
| 74 | human | 9284 | NPIPA1 | nuclear pore complex intera... | NM_006985.4 | 52.3% | 43.4% | (many diffs) |
| 75 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_024450387.1 | 51.7% | 43% | (many diffs) |
| 76 | human | 100507607 | NPIPB9 | nuclear pore complex intera... | XM_017022827.2 | 50.4% | 47.3% | (many diffs) |
| 77 | human | 440348 | NPIPB15 | nuclear pore complex intera... | XM_011523501.2 | 49.2% | 48.4% | (many diffs) |
| 78 | human | 728888 | NPIPB11 | nuclear pore complex intera... | XM_024450421.1 | 47% | 40.9% | (many diffs) |
| 79 | human | 729978 | NPIPB2 | nuclear pore complex intera... | NM_001355514.1 | 44.9% | 41.2% | (many diffs) |
| 80 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450428.1 | 44.9% | 41.2% | (many diffs) |
| 81 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450431.1 | 44.9% | 41.2% | (many diffs) |
| 82 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450429.1 | 39.8% | 36.6% | (many diffs) |
| 83 | human | 440353 | NPIPB12 | nuclear pore complex intera... | NM_001355401.1 | 38.1% | 32.2% | (many diffs) |
| 84 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450289.1 | 37.7% | 32% | (many diffs) |
| 85 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XR_001756353.1 | 37.4% | (many diffs) | |
| 86 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | XM_011522336.3 | 37% | 29.7% | (many diffs) |
| 87 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_006720917.4 | 37% | 29.5% | (many diffs) |
| 88 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522581.1 | 37% | 29.5% | (many diffs) |
| 89 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522583.3 | 37% | 29.5% | (many diffs) |
| 90 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_011522593.1 | 37% | 29.5% | (many diffs) |
| 91 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_011522594.3 | 37% | 29.5% | (many diffs) |
| 92 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_011522584.2 | 36.1% | 29.2% | (many diffs) |
| 93 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_011522595.2 | 36.1% | 29.2% | (many diffs) |
| 94 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022836.2 | 35.8% | 31% | (many diffs) |
| 95 | human | 101059938 | NPIPA7 | nuclear pore complex intera... | XM_017022840.2 | 35.8% | 31% | (many diffs) |
| 96 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_017030214.2 | 35.7% | 31.4% | (many diffs) |
| 97 | human | 729978 | NPIPB2 | nuclear pore complex intera... | XM_024450430.1 | 35% | 28% | (many diffs) |
| 98 | human | 102724993 | LOC102724993 | nuclear pore complex-intera... | XM_024452522.1 | 33.5% | 24% | (many diffs) |
| 99 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | NM_001351200.1 | 33.4% | 24% | (many diffs) |
| 100 | human | 642778 | NPIPA3 | nuclear pore complex intera... | XM_005255485.4 | 33.4% | 23.8% | (many diffs) |
| 101 | human | 642799 | NPIPA2 | nuclear pore complex intera... | XM_005255492.4 | 33.4% | 23.8% | (many diffs) |
| 102 | human | 100288332 | NPIPA5 | nuclear pore complex intera... | XR_002957772.1 | 33.4% | (many diffs) | |
| 103 | human | 23117 | NPIPB3 | nuclear pore complex intera... | NM_130464.3 | 31.9% | 26.4% | (many diffs) |
| 104 | human | 100132247 | NPIPB5 | nuclear pore complex intera... | NM_001135865.1 | 31.5% | 26.4% | (many diffs) |
| 105 | human | 613037 | NPIPB13 | nuclear pore complex intera... | NM_001321892.1 | 31.3% | 25.7% | (many diffs) |
| 106 | human | 728888 | NPIPB11 | nuclear pore complex intera... | NM_001310137.2 | 31.1% | 26.5% | (many diffs) |
| 107 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_017023247.1 | 31.1% | 26.1% | (many diffs) |
| 108 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450285.1 | 31% | 26.1% | (many diffs) |
| 109 | human | 728888 | NPIPB11 | nuclear pore complex intera... | XM_024450420.1 | 30.3% | 25.9% | (many diffs) |
| 110 | human | 440345 | NPIPB4 | nuclear pore complex intera... | NM_001310148.1 | 29.1% | 24.4% | (many diffs) |
| 111 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_017023244.2 | 29.1% | 24.4% | (many diffs) |
| 112 | human | 440345 | NPIPB4 | nuclear pore complex intera... | XM_024450283.1 | 28.4% | 23.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1434
- ORF length:
- 1365
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gatgagccgc tgtctcattc tgcaaatggt gaagctctct attgtcctga 121 ccccacagtt cctgtcgcat gaccagagcc agctcaccaa ggagctgcag cagcatgtaa 181 agtcagtgac atgcccatgc gagtacctga ggaaggttat caatagtctg gctgtctatc 241 gtcatcgtga gactgacttt ggtgtaggag ttcgagacca ccctggccaa catggcaaaa 301 ccccatctcc acaaaaattg gataatttga taattatcat tattgggttt ctgagacgtt 361 acacatttaa cattctcttc tgcacaagtt gcctttgtgt gtctttcctg aagactatct 421 tctggtctcg aaatggacat gatggatcca tggatgtaca gcagagagcc tggaggtcca 481 accacagtag acagaaaggg ctgaggtcca tttgtatgca cacaaagaaa agagtttctt 541 cctttcgagg aaataaaatt ggcctgaaag acgtcattac tctacggagg catgtggaaa 601 caaaagttag agctaaaatc cgtaagagga aggtgacaac gaaaatcaac cgtcatgaca 661 aaatcaatgg aaagaggaag accgccagaa aacagaaaat gtttcaacgt gcgcaagagt 721 tgcggcggcg ggcagaggac taccacaaat gcaaaatccc cccttctgca agaaagcctc 781 tttgcaactg ggtcagaatg gtggcagcgg agcatcgtca ttcttcagga ttgccctact 841 ggctctacct cacagctgaa actttaaaaa acaggatggg ccgccagcca cctcctccaa 901 ctcaacaaca ttctataact gataactccc tgagcctcaa gacacctcct gagtgtctgc 961 tcactcccct tccaccctca gtggatgata atatcaagga gtgtcctctt gctcctcttc 1021 caccctctcc tcttccaccc tcagtggatg ataatctgaa ggaatgtctc tttgtcccgc 1081 ttccaccctc tccTCTTCCA CCCTCAGTGG ATGATAATCT GAAGGAATGT CTCTTTGTCC 1141 CGCTTCCACC CTCTCCTCTT CCACCCTCAG TGGATGATAA TCTCAAGACT CCTCCCTTAG 1201 CTACTCAGGA GGCCGAGGTG GAAAAACCAC CCAAACCCAA GAGGTGGAGG GTGGATGAGG 1261 TGGAACAATC ACCGAAACCC AAGAGGCGGA GGGTGGATGA GGTGGAACAA TCGCCCAAGC 1321 CCAAGAGGCA GAGGGAGGCC GAGGCACAAC AATTACCCAA ACCCAAGAGG CGGAGGTTGA 1381 GTAAGCTGAG AACACGCCAT TGCACTCAAG CCTGGGCAAT AAGAATAAAT CCGTTGCCAA 1441 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 1501 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 1561 TATCTTGTGG AAAGGACGAC CAAAATCCTA CACAGGAGGT GACACGCGTT AAGTCgacaa 1621 tcaacctctg gattacaaaa tttgtgaaag att