Transcript: Human XM_017023478.1

PREDICTED: Homo sapiens LYR motif containing 1 (LYRM1), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYRM1 (57149)
Length:
1356
CDS:
83..466

Additional Resources:

NCBI RefSeq record:
XM_017023478.1
NBCI Gene record:
LYRM1 (57149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064098 CCAGTATATCTCAGATCTCAT pLKO.1 431 CDS 100% 4.950 6.930 N LYRM1 n/a
2 TRCN0000064101 GCCAATTCATCTGCCTCCAAT pLKO.1 346 CDS 100% 4.950 3.960 N LYRM1 n/a
3 TRCN0000294360 AGTTACTGTGGCTACTATAAA pLKO_005 819 3UTR 100% 15.000 10.500 N LYRM1 n/a
4 TRCN0000294304 CTAATCTAGAGGAAAGTTTAT pLKO_005 463 CDS 100% 13.200 9.240 N LYRM1 n/a
5 TRCN0000294302 TTGGCCTCTACCGCAGCATTT pLKO_005 111 CDS 100% 10.800 7.560 N LYRM1 n/a
6 TRCN0000064100 ACTGCATTACAAGATTCCTTA pLKO.1 319 CDS 100% 4.950 3.465 N LYRM1 n/a
7 TRCN0000306879 AGGAAATGGCAGGCGACATCA pLKO_005 143 CDS 100% 4.950 3.465 N LYRM1 n/a
8 TRCN0000064102 CAGACCTAATTAAACAGTGTA pLKO.1 267 CDS 100% 4.950 3.465 N LYRM1 n/a
9 TRCN0000286949 CAGACCTAATTAAACAGTGTA pLKO_005 267 CDS 100% 4.950 3.465 N LYRM1 n/a
10 TRCN0000064099 GCAGATGGAAGACACCATCAA pLKO.1 166 CDS 100% 0.495 0.347 N LYRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023478.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08710 pDONR223 100% 95.8% 95.2% None 160_174del;369T>G n/a
2 ccsbBroad304_08710 pLX_304 0% 95.8% 95.2% V5 160_174del;369T>G n/a
3 TRCN0000472126 GTCGTTAATGTTATGAGCGTACCG pLX_317 100% 95.8% 95.2% V5 160_174del;369T>G n/a
Download CSV