Transcript: Human XM_017023871.2

PREDICTED: Homo sapiens sorting nexin 29 (SNX29), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX29 (92017)
Length:
10032
CDS:
218..2830

Additional Resources:

NCBI RefSeq record:
XM_017023871.2
NBCI Gene record:
SNX29 (92017)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020937 GAACGTGACCTCCTTGCTGAA pLKO.1 850 CDS 100% 4.050 5.670 N SNX29 n/a
2 TRCN0000161256 GAGAAAGCAGCTCCAGAATTA pLKO.1 2533 CDS 100% 13.200 9.240 N SNX29 n/a
3 TRCN0000431058 AGACCAGAGTTTGTCGGATTT pLKO_005 2176 CDS 100% 10.800 7.560 N SNX29 n/a
4 TRCN0000161440 CAGCGTCATGAACAAAGTCAT pLKO.1 2560 CDS 100% 4.950 3.465 N SNX29 n/a
5 TRCN0000020938 GATCCGCTTTGGAGGGAGAAA pLKO.1 322 CDS 100% 4.950 3.465 N SNX29 n/a
6 TRCN0000160553 CATGAACAAAGTCATCCAGAT pLKO.1 2566 CDS 100% 4.050 2.835 N SNX29 n/a
7 TRCN0000020934 GAAAGGAGATTGCCTCGGATT pLKO.1 339 CDS 100% 4.050 2.835 N SNX29 n/a
8 TRCN0000020936 TGCAGTGAAACAGTGCCAGAT pLKO.1 304 CDS 100% 4.050 2.835 N SNX29 n/a
9 TRCN0000163684 GCAGCGTCATGAACAAAGTCA pLKO.1 2559 CDS 100% 3.000 2.100 N SNX29 n/a
10 TRCN0000436434 GTCTGAACTCCATACTCTTTG pLKO_005 747 CDS 100% 10.800 6.480 N SNX29 n/a
11 TRCN0000020935 CCACCGTTTCAGACCTCTTAA pLKO.1 816 CDS 100% 13.200 6.600 Y SNX29 n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 9251 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 9251 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000164032 CGAAGATGACGTGTATGGAAA pLKO.1 1306 CDS 100% 4.950 2.475 Y SNX29P1 n/a
15 TRCN0000161161 GATGATGAAGATGTGGATGAA pLKO.1 1283 CDS 100% 4.950 2.475 Y SNX29P1 n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 9249 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 9249 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 9249 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10627 pDONR223 100% 26.8% 26.2% None (many diffs) n/a
2 ccsbBroad304_10627 pLX_304 0% 26.8% 26.2% V5 (many diffs) n/a
3 TRCN0000469175 CTCCTGTAAGTGCAGTTCATTCGT pLX_317 46.9% 26.8% 26.2% V5 (many diffs) n/a
Download CSV