Transcript: Human XM_017024309.2

PREDICTED: Homo sapiens folliculin (FLCN), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLCN (201163)
Length:
3169
CDS:
505..2022

Additional Resources:

NCBI RefSeq record:
XM_017024309.2
NBCI Gene record:
FLCN (201163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237886 GATGGAGAAGCTCGCTGATTT pLKO_005 1137 CDS 100% 13.200 18.480 N FLCN n/a
2 TRCN0000237882 TCAGTATGCAGTCGCAATAAC pLKO_005 2365 3UTR 100% 13.200 18.480 N FLCN n/a
3 TRCN0000237885 CTCTCAGCAAGTACGAGTTTG pLKO_005 1658 CDS 100% 10.800 15.120 N FLCN n/a
4 TRCN0000005969 CCGGGATATATCAGCCATGAT pLKO.1 781 CDS 100% 4.950 6.930 N FLCN n/a
5 TRCN0000005970 GACCTACAAGTCACACCTCAT pLKO.1 1959 CDS 100% 4.050 5.670 N FLCN n/a
6 TRCN0000005971 CATTCAGATGAACAGTCGGAT pLKO.1 657 CDS 100% 2.640 3.696 N FLCN n/a
7 TRCN0000005968 GCTGCTTTCAACATTTACGTT pLKO.1 2798 3UTR 100% 3.000 2.400 N FLCN n/a
8 TRCN0000237884 GATAAAGAGACCTCCATTAAA pLKO_005 799 CDS 100% 15.000 10.500 N FLCN n/a
9 TRCN0000237883 CCACCATCCTGAATAAGATTG pLKO_005 1721 CDS 100% 10.800 7.560 N FLCN n/a
10 TRCN0000010979 CCCACCATCCTGAATAAGATT pLKO.1 1720 CDS 100% 5.625 3.938 N FLCN n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3132 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2965 3UTR 100% 4.950 2.475 Y C16orf89 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3132 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05196 pDONR223 100% 41.9% 39.6% None (many diffs) n/a
2 ccsbBroad304_05196 pLX_304 0% 41.9% 39.6% V5 (many diffs) n/a
3 TRCN0000472641 TAACTCGCTGGCCTCAAAGCATTC pLX_317 39.5% 41.9% 39.6% V5 (many diffs) n/a
Download CSV