Transcript: Human XM_017024705.1

PREDICTED: Homo sapiens misshapen like kinase 1 (MINK1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MINK1 (50488)
Length:
5044
CDS:
245..4270

Additional Resources:

NCBI RefSeq record:
XM_017024705.1
NBCI Gene record:
MINK1 (50488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379879 AGAGCTCGTTCACGATGTTTG pLKO_005 3114 CDS 100% 10.800 15.120 N MINK1 n/a
2 TRCN0000196775 GAACCGTAACTGCATCATGAA pLKO.1 4243 CDS 100% 4.950 6.930 N MINK1 n/a
3 TRCN0000199554 CCCTGATGCTTTCGTGATCAC pLKO.1 4417 3UTR 100% 4.050 5.670 N MINK1 n/a
4 TRCN0000272857 CCCTGATGCTTTCGTGATCAC pLKO_005 4417 3UTR 100% 4.050 5.670 N MINK1 n/a
5 TRCN0000195612 CTTTCGTGATCACGTGACCAT pLKO.1 4425 3UTR 100% 2.640 2.112 N MINK1 n/a
6 TRCN0000197268 GCGCATCATTAAGGATGTGGT pLKO.1 3994 CDS 100% 2.640 2.112 N MINK1 n/a
7 TRCN0000284882 GAGGACTGTATCGCCTATATC pLKO_005 623 CDS 100% 13.200 9.240 N MINK1 n/a
8 TRCN0000380939 GGAACAAACTGCGGGTGTATT pLKO_005 3507 CDS 100% 13.200 9.240 N MINK1 n/a
9 TRCN0000284870 AGCGGCTCAAGGTCATCTATG pLKO_005 3795 CDS 100% 10.800 7.560 N MINK1 n/a
10 TRCN0000006238 GCAGACTTTGTGTTGCTGAAA pLKO.1 2669 CDS 100% 4.950 3.465 N MINK1 n/a
11 TRCN0000006239 CCGGAAGTACAAGAAGCGATT pLKO.1 3304 CDS 100% 4.050 2.835 N MINK1 n/a
12 TRCN0000011005 GCGGATTAAGTTCCTGGTCAT pLKO.1 3646 CDS 100% 4.050 2.835 N MINK1 n/a
13 TRCN0000272858 GCGGATTAAGTTCCTGGTCAT pLKO_005 3646 CDS 100% 4.050 2.835 N MINK1 n/a
14 TRCN0000011004 CCCAGGAATTGAGTGGGCCTA pLKO.1 4520 3UTR 100% 0.720 0.504 N MINK1 n/a
15 TRCN0000006240 GCTACTGAAGTTTCCCTTCAT pLKO.1 1090 CDS 100% 0.495 0.347 N MINK1 n/a
16 TRCN0000272856 GCTACTGAAGTTTCCCTTCAT pLKO_005 1090 CDS 100% 0.495 0.347 N MINK1 n/a
17 TRCN0000025334 CGGATTAAGTTCCTGGTCATT pLKO.1 3647 CDS 100% 4.950 3.465 N Mink1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487725 GTTAGATCCCATAGCCACAACTTC pLX_317 1% 97.8% 97.8% V5 (not translated due to prior stop codon) 1347_1433del n/a
2 TRCN0000488183 AGTGTCCGTCGATCTTTACTTGCG pLX_317 8.9% 97.8% 97.8% V5 1347_1433del;3516C>A n/a
3 TRCN0000488128 GTACACACAATACATGCGTTGTTC pLX_317 8.9% 97.6% 97.5% V5 (many diffs) n/a
4 ccsbBroadEn_15055 pDONR223 39.3% 95.9% 18.3% None (many diffs) n/a
5 ccsbBroad304_15055 pLX_304 0% 95.9% 18.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000469341 TGTTGAACGGGAACAATCATACGG pLX_317 9% 95.9% 18.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV