Transcript: Human XM_017024773.2

PREDICTED: Homo sapiens ATPase H+ transporting V0 subunit a1 (ATP6V0A1), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP6V0A1 (535)
Length:
4310
CDS:
1486..3231

Additional Resources:

NCBI RefSeq record:
XM_017024773.2
NBCI Gene record:
ATP6V0A1 (535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038430 CCTGGAACTGACCGAATTAAA pLKO.1 474 5UTR 100% 15.000 12.000 N ATP6V0A1 n/a
2 TRCN0000038429 CCAGGATTGATGATCTCCAAA pLKO.1 1505 CDS 100% 4.950 3.960 N ATP6V0A1 n/a
3 TRCN0000307276 CCAGGATTGATGATCTCCAAA pLKO_005 1505 CDS 100% 4.950 3.960 N ATP6V0A1 n/a
4 TRCN0000038431 GCCGTCAGTATTTGAGGAGAA pLKO.1 2693 CDS 100% 4.050 3.240 N ATP6V0A1 n/a
5 TRCN0000291106 GCCGTCAGTATTTGAGGAGAA pLKO_005 2693 CDS 100% 4.050 3.240 N ATP6V0A1 n/a
6 TRCN0000380234 CACCCTGTCTGTGAGTCATTT pLKO_005 3343 3UTR 100% 13.200 9.240 N ATP6V0A1 n/a
7 TRCN0000381113 TGCATCTGCCACCGTAGTTTC pLKO_005 3616 3UTR 100% 10.800 7.560 N ATP6V0A1 n/a
8 TRCN0000038433 CCCAGAGTCTGGTTATTCAAT pLKO.1 2577 CDS 100% 5.625 3.938 N ATP6V0A1 n/a
9 TRCN0000333635 CCCAGAGTCTGGTTATTCAAT pLKO_005 2577 CDS 100% 5.625 3.938 N ATP6V0A1 n/a
10 TRCN0000038432 CCCTGAATATCTACTTTGGAT pLKO.1 2411 CDS 100% 3.000 2.100 N ATP6V0A1 n/a
11 TRCN0000291164 CCCTGAATATCTACTTTGGAT pLKO_005 2411 CDS 100% 3.000 2.100 N ATP6V0A1 n/a
12 TRCN0000379816 GGGTCCAGGAAGATGATATTT pLKO_005 3722 3UTR 100% 15.000 9.000 N ATP6V0A1 n/a
13 TRCN0000101518 CAGAACATAGTAGATGCTTAT pLKO.1 1840 CDS 100% 10.800 6.480 N Atp6v0a1 n/a
14 TRCN0000288573 CAGAACATAGTAGATGCTTAT pLKO_005 1840 CDS 100% 10.800 6.480 N Atp6v0a1 n/a
15 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1389 5UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00140 pDONR223 100% 69.4% 69.4% None 0_1ins768 n/a
2 ccsbBroad304_00140 pLX_304 0% 69.4% 69.4% V5 0_1ins768 n/a
3 TRCN0000468785 CAAACTTCCGTCTGTAGTTACGTC pLX_317 2.2% 69.4% 69.4% V5 0_1ins768 n/a
Download CSV