Transcript: Human XM_017024857.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 3 (MAP2K3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K3 (5606)
Length:
2189
CDS:
148..1179

Additional Resources:

NCBI RefSeq record:
XM_017024857.2
NBCI Gene record:
MAP2K3 (5606)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356084 CTCTCGACTGAATGGACTTTG pLKO_005 1575 3UTR 100% 10.800 15.120 N MAP2K3 n/a
2 TRCN0000009975 CGGACCTTCATCACCATTGGA pLKO.1 274 CDS 100% 3.000 4.200 N MAP2K3 n/a
3 TRCN0000199894 GCGAGCCATTTGTCCCAAGTG pLKO.1 1326 3UTR 100% 1.350 1.080 N MAP2K3 n/a
4 TRCN0000356056 GGATGCCATCCAAGTTGTATA pLKO_005 1544 3UTR 100% 13.200 9.240 N MAP2K3 n/a
5 TRCN0000199996 CTACCGGAAGGTGCTGGATAA pLKO.1 585 CDS 100% 10.800 7.560 N MAP2K3 n/a
6 TRCN0000377263 TGAACCAGAAGGGCTACAATG pLKO_005 854 CDS 100% 10.800 7.560 N MAP2K3 n/a
7 TRCN0000219709 TATCGGTGTCATTCACCTTTC pLKO.1 1787 3UTR 100% 6.000 4.200 N MAP2K3 n/a
8 TRCN0000219710 CTTTATGGGTTTGGCTTGTTT pLKO.1 1848 3UTR 100% 5.625 3.938 N MAP2K3 n/a
9 TRCN0000009986 GCCCTCCAATGTCCTTATCAA pLKO.1 711 CDS 100% 5.625 3.938 N MAP2K3 n/a
10 TRCN0000199303 CACAGCAAGCTGTCGGTGATC pLKO.1 676 CDS 100% 1.350 0.945 N MAP2K3 n/a
11 TRCN0000009974 CATCCTGCGGTTCCCTTACGA pLKO.1 921 CDS 100% 1.000 0.700 N MAP2K3 n/a
12 TRCN0000009985 ATTGCTGTGTCTATCGTGCGG pLKO.1 640 CDS 100% 0.540 0.378 N MAP2K3 n/a
13 TRCN0000356083 TACCGGAAGGTGCTGGATAAA pLKO_005 586 CDS 100% 0.000 0.000 N MAP2K3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489556 AAGAAAAGCCACTTGGCTTATTAC pLX_317 33.7% 97.6% 95.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487771 AGGTAAGGCCGTCACGACATAATA pLX_317 24.5% 97.5% 95.7% V5 (many diffs) n/a
3 TRCN0000491799 CTGCAATTATTATATTTTCTCCAT pLX_317 33.8% 97.5% 95.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488689 GGTGCGCGACCTCAATGTCACGTG pLX_317 36.2% 92.5% 92.4% V5 1_75del;348T>C;1029_1030insG n/a
5 TRCN0000487949 TACCATGCTTCGTGATAAGCGCGT pLX_317 26.9% 92.5% 92.1% V5 (not translated due to prior stop codon) 1_75del;954C>A;1009G>A n/a
Download CSV