Transcript: Human XM_017027849.1

PREDICTED: Homo sapiens family with sequence similarity 209 member B (FAM209B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM209B (388799)
Length:
1214
CDS:
409..1128

Additional Resources:

NCBI RefSeq record:
XM_017027849.1
NBCI Gene record:
FAM209B (388799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166978 CAATACCTTAAACGAACTTGA pLKO.1 951 CDS 100% 4.950 6.930 N FAM209B n/a
2 TRCN0000172401 CCTGTAACCTCTGTCCTGAAA pLKO.1 455 CDS 100% 4.950 3.465 N FAM209B n/a
3 TRCN0000172728 GCAGTAACCTCAAGCTTCGAA pLKO.1 1037 CDS 100% 3.000 1.800 N FAM209B n/a
4 TRCN0000172679 GCTGTTGTGCCGTTTGTGATA pLKO.1 808 CDS 100% 4.950 2.475 Y FAM209B n/a
5 TRCN0000168414 GTTCTCTTCTCTGAGACAGAA pLKO.1 675 CDS 100% 4.950 2.475 Y FAM209A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027849.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05185 pDONR223 100% 66.5% 62.7% None (many diffs) n/a
2 ccsbBroad304_05185 pLX_304 0% 66.5% 62.7% V5 (many diffs) n/a
3 TRCN0000481061 CTTAGTCTTCATCCTCGTCTTATT pLX_317 75.3% 66.5% 62.7% V5 (many diffs) n/a
4 ccsbBroadEn_13649 pDONR223 100% 41.3% 34.1% None (many diffs) n/a
5 ccsbBroad304_13649 pLX_304 0% 41.3% 34.1% V5 (many diffs) n/a
6 TRCN0000465475 AAGCAACCACGATGACCGTACCTA pLX_317 100% 41.3% 34.1% V5 (many diffs) n/a
Download CSV