Transcript: Human XM_017028643.2

PREDICTED: Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3F (APOBEC3F), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOBEC3F (200316)
Length:
2633
CDS:
2122..2427

Additional Resources:

NCBI RefSeq record:
XM_017028643.2
NBCI Gene record:
APOBEC3F (200316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052127 CCATCCTTTCTCGTCGGAATA pLKO.1 2195 CDS 100% 10.800 5.400 Y APOBEC3F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09805 pDONR223 100% 23.2% 17.8% None (many diffs) n/a
2 ccsbBroad304_09805 pLX_304 0% 23.2% 17.8% V5 (many diffs) n/a
3 TRCN0000468435 GTGTACATTTACATTTGTTTCTTA pLX_317 35% 23.2% 17.8% V5 (many diffs) n/a
4 ccsbBroadEn_03889 pDONR223 100% 23.1% 16.6% None (many diffs) n/a
5 ccsbBroad304_03889 pLX_304 0% 23.1% 16.6% V5 (many diffs) n/a
6 TRCN0000479742 GTTCGGCCGCCCCACCAAATAGGT pLX_317 26.7% 23.1% 16.6% V5 (many diffs) n/a
Download CSV