Transcript: Human XM_017028816.2

PREDICTED: Homo sapiens G2 and S-phase expressed 1 (GTSE1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTSE1 (51512)
Length:
6048
CDS:
1811..3547

Additional Resources:

NCBI RefSeq record:
XM_017028816.2
NBCI Gene record:
GTSE1 (51512)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113879 CGGCGAGATTCCTGTCTAAAT pLKO.1 3161 CDS 100% 13.200 18.480 N GTSE1 n/a
2 TRCN0000290902 CGGCGAGATTCCTGTCTAAAT pLKO_005 3161 CDS 100% 13.200 18.480 N GTSE1 n/a
3 TRCN0000113876 GCCGCTACTTTGTGTCCATTT pLKO.1 4985 3UTR 100% 10.800 15.120 N GTSE1 n/a
4 TRCN0000290901 GCCGCTACTTTGTGTCCATTT pLKO_005 4985 3UTR 100% 10.800 15.120 N GTSE1 n/a
5 TRCN0000113877 GCCAGCTTGGAATTAAATAAT pLKO.1 2009 CDS 100% 15.000 10.500 N GTSE1 n/a
6 TRCN0000290830 GCCAGCTTGGAATTAAATAAT pLKO_005 2009 CDS 100% 15.000 10.500 N GTSE1 n/a
7 TRCN0000113878 GCCTACTCCTACAAATCAATT pLKO.1 3199 CDS 100% 13.200 9.240 N GTSE1 n/a
8 TRCN0000290900 GCCTACTCCTACAAATCAATT pLKO_005 3199 CDS 100% 13.200 9.240 N GTSE1 n/a
9 TRCN0000113880 GCCTCTGTCAAACATCAGCAA pLKO.1 2905 CDS 100% 2.640 1.848 N GTSE1 n/a
10 TRCN0000290831 GCCTCTGTCAAACATCAGCAA pLKO_005 2905 CDS 100% 2.640 1.848 N GTSE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11995 pDONR223 100% 75% 75.1% None (many diffs) n/a
2 ccsbBroad304_11995 pLX_304 0% 75% 75.1% V5 (many diffs) n/a
3 TRCN0000467648 AGGTATGGGCTAAATGCAACGAAC pLX_317 20% 75% 75.1% V5 (many diffs) n/a
4 ccsbBroadEn_11994 pDONR223 100% 75% 74.9% None (many diffs) n/a
5 ccsbBroad304_11994 pLX_304 0% 75% 74.9% V5 (many diffs) n/a
6 TRCN0000475379 CTCGCGACTGTCATGCACGGACCC pLX_317 23.4% 75% 74.9% V5 (many diffs) n/a
Download CSV