Transcript: Human XM_017029268.2

PREDICTED: Homo sapiens diacylglycerol kinase kappa (DGKK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DGKK (139189)
Length:
7433
CDS:
174..3902

Additional Resources:

NCBI RefSeq record:
XM_017029268.2
NBCI Gene record:
DGKK (139189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360253 CATCTCAAGTGTTCGACTTAT pLKO_005 1726 CDS 100% 13.200 18.480 N DGKK n/a
2 TRCN0000360254 TCCGCTGCCTGTGGTGTAATT pLKO_005 1456 CDS 100% 13.200 18.480 N DGKK n/a
3 TRCN0000052546 GCAATACAATAGCCGCCTTAA pLKO.1 2822 CDS 100% 10.800 15.120 N DGKK n/a
4 TRCN0000052543 CCTGAATCTATACGCTTCAAA pLKO.1 2712 CDS 100% 5.625 7.875 N DGKK n/a
5 TRCN0000052544 GCCATGAATAAGGAGTTCAAA pLKO.1 3633 CDS 100% 5.625 3.938 N DGKK n/a
6 TRCN0000052545 CCATCTCAAGTGTTCGACTTA pLKO.1 1725 CDS 100% 4.950 3.465 N DGKK n/a
7 TRCN0000052547 GCATTGTTGGTACTCCAGTTA pLKO.1 1154 CDS 100% 4.950 3.465 N DGKK n/a
8 TRCN0000360252 ACCTTAACTTGGATCACTTAC pLKO_005 2683 CDS 100% 10.800 6.480 N DGKK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15250 pDONR223 63% 97.7% 97.7% None 3414_3415ins87 n/a
2 ccsbBroad304_15250 pLX_304 0% 97.7% 97.7% V5 3414_3415ins87 n/a
3 ccsbBroadEn_15251 pDONR223 43.5% 97.2% 19% None (many diffs) n/a
4 ccsbBroad304_15251 pLX_304 0% 97.2% 19% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000470266 TGAGCCCCTGCAGCTATTTTACCA pLX_317 10.8% 97.2% 19% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV