Transcript: Human XM_017029979.1

PREDICTED: Homo sapiens MAGE family member D1 (MAGED1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAGED1 (9500)
Length:
3345
CDS:
792..3128

Additional Resources:

NCBI RefSeq record:
XM_017029979.1
NBCI Gene record:
MAGED1 (9500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004236 AGTCCAGAATGCCACCACAAA pLKO.1 1028 CDS 100% 4.950 3.465 N MAGED1 n/a
2 TRCN0000277778 AGTCCAGAATGCCACCACAAA pLKO_005 1028 CDS 100% 4.950 3.465 N MAGED1 n/a
3 TRCN0000004235 CAGAATGTAAATCAGGCCAAA pLKO.1 1383 CDS 100% 4.050 2.835 N MAGED1 n/a
4 TRCN0000286028 CAGAATGTAAATCAGGCCAAA pLKO_005 1383 CDS 100% 4.050 2.835 N MAGED1 n/a
5 TRCN0000004237 TATTTGCTGTTCCTTGTCTAC pLKO.1 3257 3UTR 100% 4.050 2.835 N MAGED1 n/a
6 TRCN0000277721 TATTTGCTGTTCCTTGTCTAC pLKO_005 3257 3UTR 100% 4.050 2.835 N MAGED1 n/a
7 TRCN0000004238 CAAGATGAAAGTGCTGAGATT pLKO.1 2720 CDS 100% 4.950 2.970 N MAGED1 n/a
8 TRCN0000286024 CAAGATGAAAGTGCTGAGATT pLKO_005 2720 CDS 100% 4.950 2.970 N MAGED1 n/a
9 TRCN0000004239 CATTGGTTTCTTCTGGGTTGA pLKO.1 3104 CDS 100% 4.050 2.430 N MAGED1 n/a
10 TRCN0000277723 CATTGGTTTCTTCTGGGTTGA pLKO_005 3104 CDS 100% 4.050 2.430 N MAGED1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 211 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 211 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02175 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02175 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478258 TCCGGAGGTATTCTTATTGCTCAA pLX_317 15.6% 100% 100% V5 n/a
Download CSV