Transcript: Mouse XM_017312654.1

PREDICTED: Mus musculus CTF8, chromosome transmission fidelity factor 8 (Chtf8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chtf8 (214987)
Length:
2940
CDS:
498..2099

Additional Resources:

NCBI RefSeq record:
XM_017312654.1
NBCI Gene record:
Chtf8 (214987)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264481 GCTCGCTACAGCACCGGATTA pLKO_005 217 5UTR 100% 3.600 2.880 N Chtf8 n/a
2 TRCN0000264480 GCTGATCGTGGGCCATCATAT pLKO_005 288 5UTR 100% 13.200 9.240 N Chtf8 n/a
3 TRCN0000264482 GTCCTGGACCAAGTCCAAATC pLKO_005 1087 CDS 100% 10.800 7.560 N Chtf8 n/a
4 TRCN0000264479 TTGGTGACAGCACTCATCAAA pLKO_005 418 5UTR 100% 5.625 3.938 N Chtf8 n/a
5 TRCN0000200659 CAAGTCCAAATCTGAGATCAA pLKO.1 1096 CDS 100% 4.950 3.465 N Chtf8 n/a
6 TRCN0000192352 CTCCCAATCAAAGAACCTCAA pLKO.1 2733 3UTR 100% 4.050 2.835 N Chtf8 n/a
7 TRCN0000283057 CCTCCTGGGAGACCTACATTA pLKO_005 246 5UTR 100% 13.200 7.920 N Chtf8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12111 pDONR223 100% 7.5% 7.5% None (many diffs) n/a
2 ccsbBroad304_12111 pLX_304 0% 7.5% 7.5% V5 (many diffs) n/a
3 TRCN0000478217 CCTCGCCACTGTCCTGTGGCCGGC pLX_317 100% 7.5% 7.5% V5 (many diffs) n/a
Download CSV