Transcript: Mouse XM_017313702.1

PREDICTED: Mus musculus RAD54 like 2 (S. cerevisiae) (Rad54l2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rad54l2 (81000)
Length:
7320
CDS:
303..2684

Additional Resources:

NCBI RefSeq record:
XM_017313702.1
NBCI Gene record:
Rad54l2 (81000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336444 TCGGGTAGTGGATGATCTAAA pLKO_005 938 CDS 100% 13.200 18.480 N Rad54l2 n/a
2 TRCN0000336506 CAAGGAGCTTCTGACTAATTA pLKO_005 395 CDS 100% 15.000 10.500 N Rad54l2 n/a
3 TRCN0000115216 GCAGGCTCTATTGCTGTTCAT pLKO.1 2819 3UTR 100% 4.950 3.465 N Rad54l2 n/a
4 TRCN0000336503 GCAGGCTCTATTGCTGTTCAT pLKO_005 2819 3UTR 100% 4.950 3.465 N Rad54l2 n/a
5 TRCN0000115218 CCCAAACATCTTTGGATATAA pLKO.1 1027 CDS 100% 1.500 1.050 N Rad54l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11682 pDONR223 100% 53.7% 55.7% None (many diffs) n/a
2 ccsbBroad304_11682 pLX_304 0% 53.7% 55.7% V5 (many diffs) n/a
3 TRCN0000466692 TATTCTTCGGCCATCACAATACAC pLX_317 7.5% 53.7% 55.7% V5 (many diffs) n/a
Download CSV