Transcript: Mouse XM_017315247.1

PREDICTED: Mus musculus dihydrolipoamide S-succinyltransferase (E2 component of 2-oxo-glutarate complex) (Dlst), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dlst (78920)
Length:
2812
CDS:
662..1474

Additional Resources:

NCBI RefSeq record:
XM_017315247.1
NBCI Gene record:
Dlst (78920)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340713 AGTCCTCCTCCTAGACCTTTA pLKO_005 1453 CDS 100% 10.800 15.120 N Dlst n/a
2 TRCN0000181296 CCGGAAGAATGAACTTGCCAT pLKO.1 1174 CDS 100% 2.640 3.696 N Dlst n/a
3 TRCN0000177655 CGGACCATTAATGAACTAGGA pLKO.1 1145 CDS 100% 2.640 3.696 N Dlst n/a
4 TRCN0000181751 GCTGACGACTTTCAATGAGGT pLKO.1 853 CDS 100% 2.640 3.696 N Dlst n/a
5 TRCN0000216522 GTGGTGTATAGAGATTATATT pLKO.1 1037 CDS 100% 15.000 12.000 N Dlst n/a
6 TRCN0000177977 GCAGATATTGAACGGACCATT pLKO.1 1133 CDS 100% 4.950 3.960 N Dlst n/a
7 TRCN0000340634 GCAGATATTGAACGGACCATT pLKO_005 1133 CDS 100% 4.950 3.960 N Dlst n/a
8 TRCN0000217145 CAACAGGAAGATGGTCATTAA pLKO.1 129 5UTR 100% 13.200 9.240 N Dlst n/a
9 TRCN0000340635 TCCAGTAACAGTATGCTATAG pLKO_005 1784 3UTR 100% 10.800 7.560 N Dlst n/a
10 TRCN0000176785 CATGAGTAACATACAAGAGAT pLKO.1 877 CDS 100% 4.950 3.465 N Dlst n/a
11 TRCN0000340633 CATGAGTAACATACAAGAGAT pLKO_005 877 CDS 100% 4.950 3.465 N Dlst n/a
12 TRCN0000035426 CGTTCAGAACATCGGGAGAAA pLKO.1 770 CDS 100% 4.950 3.465 N DLST n/a
13 TRCN0000311637 CGTTCAGAACATCGGGAGAAA pLKO_005 770 CDS 100% 4.950 3.465 N DLST n/a
14 TRCN0000035424 GCCTGTTGTAAATGCAGTGAT pLKO.1 997 CDS 100% 4.950 3.465 N DLST n/a
15 TRCN0000311638 GCCTGTTGTAAATGCAGTGAT pLKO_005 997 CDS 100% 4.950 3.465 N DLST n/a
16 TRCN0000177249 GCCTTAATGGATGCTCATTAA pLKO.1 1716 3UTR 100% 1.320 0.924 N Dlst n/a
17 TRCN0000340712 ACAACAGGAAGATGGTCATTA pLKO_005 128 5UTR 100% 13.200 7.920 N Dlst n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315247.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06100 pDONR223 100% 53.6% 56.7% None (many diffs) n/a
2 ccsbBroad304_06100 pLX_304 0% 53.6% 56.7% V5 (many diffs) n/a
3 TRCN0000465484 CGGAAGATATTGTACATCACAGAT pLX_317 28.2% 53.6% 56.7% V5 (many diffs) n/a
Download CSV