Transcript: Mouse XM_017316022.1

PREDICTED: Mus musculus Rho-related BTB domain containing 2 (Rhobtb2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rhobtb2 (246710)
Length:
4790
CDS:
13..2265

Additional Resources:

NCBI RefSeq record:
XM_017316022.1
NBCI Gene record:
Rhobtb2 (246710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047964 GCCAAACGTAGAGACCATCAA pLKO.1 105 CDS 100% 4.950 6.930 N RHOBTB2 n/a
2 TRCN0000097142 CGAGAGAAAGAGGACTATTTA pLKO.1 2131 CDS 100% 15.000 12.000 N Rhobtb2 n/a
3 TRCN0000097141 CCTCATGCACATTGCTCACAT pLKO.1 1410 CDS 100% 4.950 3.465 N Rhobtb2 n/a
4 TRCN0000097143 CTGGATGATATGAAGCTCATT pLKO.1 1783 CDS 100% 4.950 3.465 N Rhobtb2 n/a
5 TRCN0000097139 CCTCTATTATTATGTGGCTAT pLKO.1 3221 3UTR 100% 4.050 2.835 N Rhobtb2 n/a
6 TRCN0000097140 CCTGGATGATATGAAGCTCAT pLKO.1 1782 CDS 100% 4.050 2.835 N Rhobtb2 n/a
7 TRCN0000047966 CCATGTCAAGACCATGTGGTA pLKO.1 426 CDS 100% 2.640 1.848 N RHOBTB2 n/a
8 TRCN0000047967 GCACCAACTACAACAACGTGT pLKO.1 1985 CDS 100% 2.640 1.584 N RHOBTB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07857 pDONR223 100% 87.6% 94.6% None (many diffs) n/a
2 ccsbBroad304_07857 pLX_304 0% 87.6% 94.6% V5 (many diffs) n/a
3 TRCN0000477987 ACGAAAGATTAGGCACAAGGACTT pLX_317 6.9% 87.6% 94.6% V5 (many diffs) n/a
Download CSV