Transcript: Mouse XM_017317742.1

PREDICTED: Mus musculus FERM domain containing 5 (Frmd5), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Frmd5 (228564)
Length:
4916
CDS:
257..1783

Additional Resources:

NCBI RefSeq record:
XM_017317742.1
NBCI Gene record:
Frmd5 (228564)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071902 GTCCACTTCATTAAATGGAAT pLKO.1 968 CDS 100% 4.950 6.435 N Frmd5 n/a
2 TRCN0000071901 CCGCCTTGTTAGCGGCCTATA pLKO.1 654 CDS 100% 3.600 2.880 N Frmd5 n/a
3 TRCN0000071900 GCACCTCTGGAAATGTGGAAT pLKO.1 1099 CDS 100% 4.950 3.465 N Frmd5 n/a
4 TRCN0000071899 GCTGAGATTCACAAGACCGAA pLKO.1 782 CDS 100% 2.640 1.848 N Frmd5 n/a
5 TRCN0000071898 CCCAGAATCTTCAGGTCATTT pLKO.1 4411 3UTR 100% 13.200 7.920 N Frmd5 n/a
6 TRCN0000420899 CAGTGTCCAGCAGCAATTTAT pLKO_005 1167 CDS 100% 15.000 10.500 N FRMD5 n/a
7 TRCN0000427102 ACCTACTTGAGAAAGACTATT pLKO_005 408 CDS 100% 13.200 9.240 N FRMD5 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3024 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04460 pDONR223 100% 82.1% 83.1% None (many diffs) n/a
2 ccsbBroad304_04460 pLX_304 0% 82.1% 83.1% V5 (many diffs) n/a
3 TRCN0000474059 TCGCGCAACGAACCCGAAAAGTAT pLX_317 21.4% 82.1% 83.1% V5 (many diffs) n/a
4 TRCN0000489266 GTTACTGTCGCAATGCCTAACCAT pLX_317 21% 82.1% 83.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488208 TTAAATAGAAGTAGCAAACTCACT pLX_317 16.9% 82% 83% V5 (many diffs) n/a
Download CSV