Transcript: Mouse XM_017317803.1

PREDICTED: Mus musculus cytochrome b5 type A (microsomal) (Cyb5a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyb5a (109672)
Length:
569
CDS:
138..434

Additional Resources:

NCBI RefSeq record:
XM_017317803.1
NBCI Gene record:
Cyb5a (109672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175815 GATCCTGCATCATAAGGTGTA pLKO.1 221 CDS 100% 4.050 3.240 N Cyb5a n/a
2 TRCN0000292805 GATCCTGCATCATAAGGTGTA pLKO_005 221 CDS 100% 4.050 3.240 N Cyb5a n/a
3 TRCN0000175729 GAAGAAGTCCTAAGAGAGCAA pLKO.1 279 CDS 100% 2.640 2.112 N Cyb5a n/a
4 TRCN0000292873 GAAGAAGTCCTAAGAGAGCAA pLKO_005 279 CDS 100% 2.640 2.112 N Cyb5a n/a
5 TRCN0000175344 CCATCCAGATGACAGATCAAA pLKO.1 389 CDS 100% 5.625 3.938 N Cyb5a n/a
6 TRCN0000292872 CCATCCAGATGACAGATCAAA pLKO_005 389 CDS 100% 5.625 3.938 N Cyb5a n/a
7 TRCN0000193916 CTGTGGAGTCTAATTCCAGTT pLKO.1 461 3UTR 100% 4.050 2.835 N Cyb5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317803.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00401 pDONR223 100% 63.1% 63.4% None (many diffs) n/a
2 ccsbBroad304_00401 pLX_304 0% 63.1% 63.4% V5 (many diffs) n/a
3 TRCN0000475059 GCCACATACAAACGTAGACCTTTA pLX_317 77.7% 63.1% 63.4% V5 (many diffs) n/a
4 TRCN0000488397 AATTGGCTATTAGTACGTGATGGT pLX_317 68.6% 63.1% 63.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV