Transcript: Mouse XM_017317833.1

PREDICTED: Mus musculus UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (Galnt1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Galnt1 (14423)
Length:
3296
CDS:
205..1338

Additional Resources:

NCBI RefSeq record:
XM_017317833.1
NBCI Gene record:
Galnt1 (14423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110291 GCCTAAGACGTAAACTACAAT pLKO.1 860 CDS 100% 5.625 7.875 N Galnt1 n/a
2 TRCN0000335167 GCCTAAGACGTAAACTACAAT pLKO_005 860 CDS 100% 5.625 7.875 N Galnt1 n/a
3 TRCN0000110294 CCAGGTGTTACAAAGGTAGAT pLKO.1 814 CDS 100% 4.950 3.465 N Galnt1 n/a
4 TRCN0000335091 CCAGGTGTTACAAAGGTAGAT pLKO_005 814 CDS 100% 4.950 3.465 N Galnt1 n/a
5 TRCN0000110290 GCCACATTCTTCAGTAGCAAA pLKO.1 1402 3UTR 100% 4.950 3.465 N Galnt1 n/a
6 TRCN0000335085 GCCACATTCTTCAGTAGCAAA pLKO_005 1402 3UTR 100% 4.950 3.465 N Galnt1 n/a
7 TRCN0000110293 CCCAGTGAAATTAACCCTGCA pLKO.1 1185 CDS 100% 2.160 1.512 N Galnt1 n/a
8 TRCN0000335092 CCCAGTGAAATTAACCCTGCA pLKO_005 1185 CDS 100% 2.160 1.512 N Galnt1 n/a
9 TRCN0000035604 CCAAACTTAATGGCCCAGTTA pLKO.1 1115 CDS 100% 4.950 3.465 N GALNT1 n/a
10 TRCN0000035605 CCCAGCATTAGAGACTGCAAT pLKO.1 1261 CDS 100% 4.950 3.465 N GALNT1 n/a
11 TRCN0000291912 CCCAGCATTAGAGACTGCAAT pLKO_005 1261 CDS 100% 4.950 3.465 N GALNT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317833.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488736 TGCGTGTCCTTAACCATCACACGT pLX_317 20.9% 62.8% 66.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487916 ATAACTACTAGACCTGACTGATGA pLX_317 18.7% 62.8% 66.4% V5 (many diffs) n/a
Download CSV