Transcript: Mouse XM_017317866.1

PREDICTED: Mus musculus WW domain containing adaptor with coiled-coil (Wac), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wac (225131)
Length:
4660
CDS:
275..1771

Additional Resources:

NCBI RefSeq record:
XM_017317866.1
NBCI Gene record:
Wac (225131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194476 GCGAGAGCAGAGGATACTATT pLKO.1 1690 CDS 100% 13.200 18.480 N Wac n/a
2 TRCN0000345719 GCGAGAGCAGAGGATACTATT pLKO_005 1690 CDS 100% 13.200 18.480 N Wac n/a
3 TRCN0000174815 GTGCACTTCATAGTTCAAATT pLKO.1 453 CDS 100% 13.200 18.480 N Wac n/a
4 TRCN0000345645 GTGCACTTCATAGTTCAAATT pLKO_005 453 CDS 100% 13.200 18.480 N Wac n/a
5 TRCN0000345721 CAATGCTGAGGTGGCTAAATA pLKO_005 2057 3UTR 100% 15.000 10.500 N Wac n/a
6 TRCN0000345720 GCGTGAAGAAGCCCATAATAT pLKO_005 1585 CDS 100% 15.000 10.500 N Wac n/a
7 TRCN0000193841 CCAGTTACTCTCCACAAGAAA pLKO.1 417 CDS 100% 5.625 3.938 N Wac n/a
8 TRCN0000345718 CCAGTTACTCTCCACAAGAAA pLKO_005 417 CDS 100% 5.625 3.938 N Wac n/a
9 TRCN0000175829 GCATCAAGATTGCGTGAAGAA pLKO.1 1574 CDS 100% 4.950 3.465 N Wac n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317866.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11974 pDONR223 100% 70.2% 71.4% None (many diffs) n/a
2 ccsbBroad304_11974 pLX_304 0% 70.2% 71.4% V5 (many diffs) n/a
3 TRCN0000480363 TCCTATGTCTCACCCTGGACAAAC pLX_317 23.5% 70.2% 71.4% V5 (many diffs) n/a
Download CSV