Transcript: Mouse XM_017318068.1

PREDICTED: Mus musculus Janus kinase 2 (Jak2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jak2 (16452)
Length:
4172
CDS:
771..2954

Additional Resources:

NCBI RefSeq record:
XM_017318068.1
NBCI Gene record:
Jak2 (16452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023652 CGTGGAATTTATGCGAATGAT pLKO.1 2729 CDS 100% 5.625 7.875 N Jak2 n/a
2 TRCN0000278125 CGTGGAATTTATGCGAATGAT pLKO_005 2729 CDS 100% 5.625 7.875 N Jak2 n/a
3 TRCN0000023651 CGGCCCAATATCAATGGATTT pLKO.1 758 5UTR 100% 10.800 8.640 N Jak2 n/a
4 TRCN0000278192 CGGCCCAATATCAATGGATTT pLKO_005 758 5UTR 100% 10.800 8.640 N Jak2 n/a
5 TRCN0000023653 CCAACATTACAGAGGCATAAT pLKO.1 1125 CDS 100% 13.200 9.240 N Jak2 n/a
6 TRCN0000278124 CCAACATTACAGAGGCATAAT pLKO_005 1125 CDS 100% 13.200 9.240 N Jak2 n/a
7 TRCN0000023649 CCTGGCAACAAGGAACATATT pLKO.1 2483 CDS 100% 13.200 9.240 N Jak2 n/a
8 TRCN0000278126 CCTGGCAACAAGGAACATATT pLKO_005 2483 CDS 100% 13.200 9.240 N Jak2 n/a
9 TRCN0000023650 CCGTGATCTTAACAGCCTGTT pLKO.1 1961 CDS 100% 4.050 2.430 N Jak2 n/a
10 TRCN0000278190 CCGTGATCTTAACAGCCTGTT pLKO_005 1961 CDS 100% 4.050 2.430 N Jak2 n/a
11 TRCN0000003179 CACAGTTTGAAGAGAGACATT pLKO.1 2080 CDS 100% 4.950 3.465 N JAK2 n/a
12 TRCN0000350495 CACAGTTTGAAGAGAGACATT pLKO_005 2080 CDS 100% 4.950 3.465 N JAK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318068.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10929 pDONR223 100% 57.2% 61.3% None (many diffs) n/a
2 ccsbBroad304_10929 pLX_304 0% 57.2% 61.3% V5 (many diffs) n/a
3 ccsbBroadEn_14680 pDONR223 0% 57.1% 61.2% None (many diffs) n/a
4 TRCN0000472785 CCCCCACGAGTCAAACATTTAGTC pLX_317 12.6% 57% 61.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroad304_14680 pLX_304 14.6% 54.6% 48.7% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488199 AACGTGGACCCGTCCGTGGCAGGT pLX_317 8.7% 57.1% 61.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV