Transcript: Mouse XM_017319591.1

PREDICTED: Mus musculus abhydrolase domain containing 18 (Abhd18), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abhd18 (269423)
Length:
3827
CDS:
96..1490

Additional Resources:

NCBI RefSeq record:
XM_017319591.1
NBCI Gene record:
Abhd18 (269423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265020 ACTACGGGTGTATTGAGTAAA pLKO_005 789 CDS 100% 13.200 18.480 N Abhd18 n/a
2 TRCN0000265017 TTACAAACTGTGGATACATTT pLKO_005 1625 3UTR 100% 13.200 18.480 N Abhd18 n/a
3 TRCN0000265019 TACCCGGTACACATCGATAAG pLKO_005 252 CDS 100% 0.000 0.000 N Abhd18 n/a
4 TRCN0000217883 GCCAAAGAGGATGCCTATATT pLKO.1 1311 CDS 100% 15.000 10.500 N Abhd18 n/a
5 TRCN0000265018 GCCAAAGAGGATGCCTATATT pLKO_005 1311 CDS 100% 15.000 10.500 N Abhd18 n/a
6 TRCN0000283262 GATGATTGGAAATCGAGAAAG pLKO_005 206 CDS 100% 10.800 7.560 N Abhd18 n/a
7 TRCN0000201476 CAAGTTACAACCCTCAGTCAT pLKO.1 1150 CDS 100% 4.950 3.465 N Abhd18 n/a
8 TRCN0000191079 CCTGAAGTATTTGTAACTCTT pLKO.1 1678 3UTR 100% 4.950 3.465 N Abhd18 n/a
9 TRCN0000190699 GCCTTTGAACGTTTCCTTCAT pLKO.1 1455 CDS 100% 4.950 3.465 N Abhd18 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3800 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3790 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319591.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12675 pDONR223 100% 62.1% 62% None (many diffs) n/a
2 ccsbBroad304_12675 pLX_304 0% 62.1% 62% V5 (many diffs) n/a
3 TRCN0000475662 CCTCAGTGAGCCAAGCCACAAATC pLX_317 28.2% 62.1% 62% V5 (many diffs) n/a
4 ccsbBroadEn_12676 pDONR223 100% 61.3% 61.6% None (many diffs) n/a
5 ccsbBroad304_12676 pLX_304 0% 61.3% 61.6% V5 (many diffs) n/a
6 TRCN0000480245 AGGGTAGTTCTAAACACTCTTCTT pLX_317 29.2% 61.3% 61.6% V5 (many diffs) n/a
Download CSV