Transcript: Mouse XM_017319667.1

PREDICTED: Mus musculus muscleblind-like 1 (Drosophila) (Mbnl1), transcript variant X31, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbnl1 (56758)
Length:
4797
CDS:
879..1748

Additional Resources:

NCBI RefSeq record:
XM_017319667.1
NBCI Gene record:
Mbnl1 (56758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063964 GCCAACCAGATACCCATAATA pLKO.1 1683 CDS 100% 15.000 21.000 N MBNL1 n/a
2 TRCN0000226191 GCCAACCAGATACCCATAATA pLKO_005 1683 CDS 100% 15.000 21.000 N Mbnl1 n/a
3 TRCN0000419160 ATTTGTGCTGAGGTGATATTC pLKO_005 1965 3UTR 100% 13.200 18.480 N MBNL1 n/a
4 TRCN0000226192 CAGATCGATATCTACCAATTT pLKO_005 4598 3UTR 100% 13.200 18.480 N Mbnl1 n/a
5 TRCN0000063963 GCAGTCTTTAACACTGGTATT pLKO.1 1476 CDS 100% 10.800 15.120 N MBNL1 n/a
6 TRCN0000063967 CCCATAATATCTGCCGAACAT pLKO.1 1695 CDS 100% 4.950 6.930 N MBNL1 n/a
7 TRCN0000226190 TTCTCCCACCAGGCTCAATAT pLKO_005 1549 CDS 100% 13.200 10.560 N Mbnl1 n/a
8 TRCN0000102630 GCACAGAGTTAGCACTCCATA pLKO.1 4305 3UTR 100% 4.950 3.960 N Mbnl1 n/a
9 TRCN0000102634 AGCCAACCAGATACCCATAAT pLKO.1 1682 CDS 100% 13.200 9.240 N Mbnl1 n/a
10 TRCN0000226189 CAGTCTTTAACACTGGTATTT pLKO_005 1477 CDS 100% 13.200 9.240 N Mbnl1 n/a
11 TRCN0000219085 TGACAGCACAATGATTGATAC pLKO_005 1217 CDS 100% 10.800 7.560 N Mbnl1 n/a
12 TRCN0000102633 GAAGTATGTAGAGAGTTTCAA pLKO.1 102 5UTR 100% 5.625 3.938 N Mbnl1 n/a
13 TRCN0000102631 CGCAGTCTTTAACACTGGTAT pLKO.1 1475 CDS 100% 4.950 3.465 N Mbnl1 n/a
14 TRCN0000102632 GCCTGCTTTGATTCACTGAAA pLKO.1 207 5UTR 100% 4.950 3.465 N Mbnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15496 pDONR223 0% 79.8% 83.9% None (many diffs) n/a
2 ccsbBroad304_15496 pLX_304 0% 79.8% 83.9% V5 (many diffs) n/a
3 ccsbBroadEn_00980 pDONR223 100% 71.7% 75.3% None (many diffs) n/a
4 ccsbBroad304_00980 pLX_304 0% 71.7% 75.3% V5 (many diffs) n/a
5 TRCN0000467871 TGTGAAGGTACTCGGCAACAGACC pLX_317 30.6% 71.7% 75.3% V5 (many diffs) n/a
Download CSV