Transcript: Mouse XM_017319716.1

PREDICTED: Mus musculus sodium channel modifier 1 (Scnm1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scnm1 (69269)
Length:
547
CDS:
151..501

Additional Resources:

NCBI RefSeq record:
XM_017319716.1
NBCI Gene record:
Scnm1 (69269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126939 GTCGATGGATAAAGGATGAAA pLKO.1 483 CDS 100% 5.625 7.875 N Scnm1 n/a
2 TRCN0000326532 GTCGATGGATAAAGGATGAAA pLKO_005 483 CDS 100% 5.625 7.875 N Scnm1 n/a
3 TRCN0000126943 GAGTCAACTCAATGTGCTCAA pLKO.1 180 CDS 100% 4.050 5.670 N Scnm1 n/a
4 TRCN0000326533 GAGTCAACTCAATGTGCTCAA pLKO_005 180 CDS 100% 4.050 5.670 N Scnm1 n/a
5 TRCN0000005676 AGTCAACTCAATGTGCTCAAA pLKO.1 181 CDS 100% 4.950 3.465 N SCNM1 n/a
6 TRCN0000280240 AGTCAACTCAATGTGCTCAAA pLKO_005 181 CDS 100% 4.950 3.465 N SCNM1 n/a
7 TRCN0000126941 GAAGCATTTGTCCAGTCTGAA pLKO.1 348 CDS 100% 4.950 3.465 N Scnm1 n/a
8 TRCN0000326535 GAAGCATTTGTCCAGTCTGAA pLKO_005 348 CDS 100% 4.950 3.465 N Scnm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04020 pDONR223 100% 44.6% 40.2% None (many diffs) n/a
2 ccsbBroad304_04020 pLX_304 0% 44.6% 40.2% V5 (many diffs) n/a
3 TRCN0000470429 TGTATACAGTGCAGACGAGCGACC pLX_317 61.6% 44.6% 40.2% V5 (many diffs) n/a
Download CSV