Transcript: Mouse XM_017320173.1

PREDICTED: Mus musculus potassium channel tetramerisation domain containing 3 (Kctd3), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kctd3 (226823)
Length:
3180
CDS:
504..2150

Additional Resources:

NCBI RefSeq record:
XM_017320173.1
NBCI Gene record:
Kctd3 (226823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069415 CGAGATGAAACTGGTGCTATA pLKO.1 65 5UTR 100% 10.800 15.120 N Kctd3 n/a
2 TRCN0000069417 GACACGATTCAGAGGGATGAT pLKO.1 1058 CDS 100% 4.950 6.930 N Kctd3 n/a
3 TRCN0000413081 ATCCAAGAAAGGTGCTAATAG pLKO_005 450 5UTR 100% 13.200 9.240 N Kctd3 n/a
4 TRCN0000435583 CTCAGGCACGAGGCAGAATTT pLKO_005 176 5UTR 100% 13.200 9.240 N Kctd3 n/a
5 TRCN0000437335 TGCAGGACGTTGTCCCAATAA pLKO_005 646 CDS 100% 13.200 9.240 N Kctd3 n/a
6 TRCN0000418961 CCAGGCATTCCCAGTCGTAAA pLKO_005 293 5UTR 100% 10.800 7.560 N Kctd3 n/a
7 TRCN0000436993 GCTCATGTGGATTCCAGATTC pLKO_005 4 5UTR 100% 10.800 7.560 N Kctd3 n/a
8 TRCN0000069413 CCCTTATGATTGTGGAGTGTT pLKO.1 2544 3UTR 100% 4.950 3.465 N Kctd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11952 pDONR223 100% 55.2% 61.7% None (many diffs) n/a
2 ccsbBroad304_11952 pLX_304 0% 55.2% 61.7% V5 (many diffs) n/a
3 TRCN0000477450 AATATCTAGTGGAAGTGATTGTGA pLX_317 11.8% 55.2% 61.7% V5 (many diffs) n/a
4 ccsbBroadEn_08229 pDONR223 100% 55.1% 61.5% None (many diffs) n/a
5 ccsbBroad304_08229 pLX_304 0% 55.1% 61.5% V5 (many diffs) n/a
6 TRCN0000492353 GAATGTATTCGATCCTGATCAGAA pLX_317 20.6% 55.1% 61.5% V5 (many diffs) n/a
Download CSV