Transcript: Mouse XM_017320880.1

PREDICTED: Mus musculus ARP3 actin-related protein 3B (Actr3b), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Actr3b (242894)
Length:
2088
CDS:
477..1346

Additional Resources:

NCBI RefSeq record:
XM_017320880.1
NBCI Gene record:
Actr3b (242894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090297 GCTAAGTATGACGTAGATCCT pLKO.1 816 CDS 100% 2.640 3.696 N Actr3b n/a
2 TRCN0000090293 CCGAGATTCTAGTCAAGTGTA pLKO.1 1586 3UTR 100% 4.950 3.465 N Actr3b n/a
3 TRCN0000090294 GCCCGGATATTGTCAGAGAAT pLKO.1 793 CDS 100% 4.950 3.465 N Actr3b n/a
4 TRCN0000090296 CCAGGACTCTACATTGCAGTA pLKO.1 498 CDS 100% 4.050 2.835 N Actr3b n/a
5 TRCN0000090295 CCGCTGTATAAGAACGTCGTT pLKO.1 1029 CDS 100% 2.640 1.848 N Actr3b n/a
6 TRCN0000108327 CCAGGACTCTACATTGCAGTT pLKO.1 498 CDS 100% 4.050 2.835 N ACTR3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03803 pDONR223 100% 62% 67.9% None (many diffs) n/a
2 ccsbBroad304_03803 pLX_304 0% 62% 67.9% V5 (many diffs) n/a
3 TRCN0000480353 AATTTTCGGGTCTCCGCCAGAGAG pLX_317 33.6% 62% 67.9% V5 (many diffs) n/a
4 ccsbBroadEn_03802 pDONR223 100% 47.8% 51.6% None (many diffs) n/a
5 ccsbBroad304_03802 pLX_304 0% 47.8% 51.6% V5 (many diffs) n/a
6 TRCN0000491360 AAGTAAGAACTACCAGACTCACCT pLX_317 33.1% 47.8% 51.6% V5 (many diffs) n/a
Download CSV