Transcript: Mouse XM_017321076.1

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class N (Pign), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pign (27392)
Length:
6675
CDS:
320..3115

Additional Resources:

NCBI RefSeq record:
XM_017321076.1
NBCI Gene record:
Pign (27392)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126402 CCTCTTAATTCGGTGGGAATA pLKO.1 1328 CDS 100% 10.800 15.120 N Pign n/a
2 TRCN0000126400 GCCAAACCTTTCTCTAGTAAT pLKO.1 2161 CDS 100% 13.200 9.240 N Pign n/a
3 TRCN0000126401 CCTGTAGAATTTGACTCTCTT pLKO.1 677 CDS 100% 4.950 3.465 N Pign n/a
4 TRCN0000126399 GCATCCTGATTCTCCTTCTTA pLKO.1 3141 3UTR 100% 5.625 3.375 N Pign n/a
5 TRCN0000126403 GCTTGTCTTTACCTTGGGTAT pLKO.1 1963 CDS 100% 4.050 2.430 N Pign n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07902 pDONR223 100% 86.4% 87.5% None (many diffs) n/a
2 ccsbBroad304_07902 pLX_304 0% 86.4% 87.5% V5 (many diffs) n/a
3 TRCN0000478909 CATGCCTACAGCTCCCATTTCCCG pLX_317 13% 86.4% 87.5% V5 (many diffs) n/a
Download CSV