Transcript: Mouse XM_017321111.1

PREDICTED: Mus musculus FRY like transcription coactivator (Fryl), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fryl (72313)
Length:
11728
CDS:
569..9880

Additional Resources:

NCBI RefSeq record:
XM_017321111.1
NBCI Gene record:
Fryl (72313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340904 ACGTTCACAGCAGGCATTAAC pLKO_005 5924 CDS 100% 13.200 18.480 N Fryl n/a
2 TRCN0000340907 GACGAAGGGTCATACGTTATT pLKO_005 8591 CDS 100% 13.200 18.480 N Fryl n/a
3 TRCN0000174675 GCATATCATTGCGGATTTATA pLKO.1 1375 CDS 100% 15.000 12.000 N Fryl n/a
4 TRCN0000216667 CATAACGGATGGACGGATAAA pLKO.1 6742 CDS 100% 13.200 10.560 N Fryl n/a
5 TRCN0000352546 GTACAGCTGGTACGGATATTT pLKO_005 3800 CDS 100% 15.000 10.500 N Fryl n/a
6 TRCN0000340981 ATAACGGATGGACGGATAAAC pLKO_005 6743 CDS 100% 13.200 9.240 N Fryl n/a
7 TRCN0000192886 GCAGTCAAATGCAGAAGGAAT pLKO.1 6247 CDS 100% 4.950 2.970 N Fryl n/a
8 TRCN0000340905 ACCCTTGTGCTTCATTGATAA pLKO_005 9950 3UTR 100% 13.200 6.600 Y Fryl n/a
9 TRCN0000282485 AGTGCCTTAGTGGCGAATATT pLKO_005 3992 CDS 100% 15.000 21.000 N FRYL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13553 pDONR223 100% 10.9% 11.8% None (many diffs) n/a
2 ccsbBroad304_13553 pLX_304 0% 10.9% 11.8% V5 (many diffs) n/a
3 TRCN0000469567 TTGGATCTCAGGTTGACTCAGATT pLX_317 41.1% 10.9% 11.8% V5 (many diffs) n/a
Download CSV