Transcript: Mouse XM_017321737.1

PREDICTED: Mus musculus RasGEF domain family, member 1A (Rasgef1a), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rasgef1a (70727)
Length:
3349
CDS:
165..1643

Additional Resources:

NCBI RefSeq record:
XM_017321737.1
NBCI Gene record:
Rasgef1a (70727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341898 GTTCCAACGGTGGACTATTAT pLKO_005 369 CDS 100% 15.000 21.000 N Rasgef1a n/a
2 TRCN0000341900 CCTACCCAATGGGCACATTAA pLKO_005 1394 CDS 100% 13.200 18.480 N Rasgef1a n/a
3 TRCN0000341897 CATTGCCCAAATGATACAAAG pLKO_005 680 CDS 100% 10.800 8.640 N Rasgef1a n/a
4 TRCN0000341896 GTAACCATGGTAACATCTTAT pLKO_005 1902 3UTR 100% 13.200 9.240 N Rasgef1a n/a
5 TRCN0000341828 ATCGGGAACTTCAACTCTATG pLKO_005 1116 CDS 100% 10.800 7.560 N Rasgef1a n/a
6 TRCN0000047372 CCTCTTCGTTAAGGACATCTA pLKO.1 1346 CDS 100% 4.950 3.465 N RASGEF1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13418 pDONR223 100% 77.7% 82.5% None (many diffs) n/a
2 ccsbBroad304_13418 pLX_304 0% 77.7% 82.5% V5 (many diffs) n/a
3 TRCN0000466422 CACAAGGAGCGTGCCTGTATGTTT pLX_317 32.6% 77.7% 82.5% V5 (many diffs) n/a
Download CSV