Transcript: Mouse XM_017321929.1

PREDICTED: Mus musculus egl-9 family hypoxia-inducible factor 2 (Egln2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Egln2 (112406)
Length:
1507
CDS:
113..1009

Additional Resources:

NCBI RefSeq record:
XM_017321929.1
NBCI Gene record:
Egln2 (112406)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273706 AGGTGTTCAAGTACCAGTATC pLKO_005 967 CDS 100% 10.800 15.120 N Egln2 n/a
2 TRCN0000009744 CGTTGAGTGTAGAGCTGAGAA pLKO.1 1245 3UTR 100% 4.950 6.930 N Egln2 n/a
3 TRCN0000284925 CGTTGAGTGTAGAGCTGAGAA pLKO_005 1245 3UTR 100% 4.950 6.930 N Egln2 n/a
4 TRCN0000022326 GCCACTCTTTGACCGGTTGCT pLKO.1 808 CDS 100% 0.880 1.232 N EGLN2 n/a
5 TRCN0000318601 GCCACTCTTTGACCGGTTGCT pLKO_005 808 CDS 100% 0.880 1.232 N EGLN2 n/a
6 TRCN0000009747 GCCAACATCGAGCCACTCTTT pLKO.1 797 CDS 100% 4.950 3.465 N Egln2 n/a
7 TRCN0000273754 GCCAACATCGAGCCACTCTTT pLKO_005 797 CDS 100% 4.950 3.465 N Egln2 n/a
8 TRCN0000009746 GAATCAGAACTGGGATGTTAA pLKO.1 727 CDS 100% 13.200 7.920 N Egln2 n/a
9 TRCN0000273016 GAATCAGAACTGGGATGTTAA pLKO_005 727 CDS 100% 13.200 7.920 N Egln2 n/a
10 TRCN0000022325 GCTGCATCACCTGTATCTATT pLKO.1 702 CDS 100% 13.200 7.920 N EGLN2 n/a
11 TRCN0000318672 GCTGCATCACCTGTATCTATT pLKO_005 702 CDS 100% 13.200 7.920 N EGLN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321929.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14348 pDONR223 100% 39.5% 40.9% None (many diffs) n/a
2 ccsbBroad304_14348 pLX_304 0% 39.5% 40.9% V5 (many diffs) n/a
3 TRCN0000472254 GTTTATTACAACGAGACATCGATC pLX_317 90.6% 39.5% 40.9% V5 (many diffs) n/a
Download CSV