Transcript: Mouse XM_017321949.1

PREDICTED: Mus musculus aryl hydrocarbon receptor nuclear translocator-like (Arntl), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arntl (11865)
Length:
2902
CDS:
518..2395

Additional Resources:

NCBI RefSeq record:
XM_017321949.1
NBCI Gene record:
Arntl (11865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095056 CGACACGCAATAGATGGGAAA pLKO.1 1541 CDS 100% 4.050 5.670 N Arntl n/a
2 TRCN0000095054 CCATTGATACAAGTCAATCTA pLKO.1 2526 3UTR 100% 0.563 0.450 N Arntl n/a
3 TRCN0000262534 TCTTCAAGATCCTCAATTATA pLKO_005 1044 CDS 100% 15.000 10.500 N Arntl n/a
4 TRCN0000095058 CCCTCATGGAAGGTTAGAATA pLKO.1 685 CDS 100% 13.200 9.240 N Arntl n/a
5 TRCN0000282305 GACGAACTGAAACACCTAATT pLKO_005 950 CDS 100% 13.200 9.240 N Arntl n/a
6 TRCN0000262535 ACATAGGCATCGATATGATAG pLKO_005 2247 CDS 100% 10.800 7.560 N Arntl n/a
7 TRCN0000095055 CGCGGAGGAAATCATGGAAAT pLKO.1 2011 CDS 100% 10.800 7.560 N Arntl n/a
8 TRCN0000095057 GCCAAAGTTAAGGAACAGCTA pLKO.1 1121 CDS 100% 2.640 1.848 N Arntl n/a
9 TRCN0000282303 GCAGTATCAAAGTGCATTAAT pLKO_005 2422 3UTR 100% 15.000 9.000 N Arntl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00105 pDONR223 100% 91.3% 98.4% None (many diffs) n/a
2 ccsbBroad304_00105 pLX_304 35.1% 91.3% 98.4% V5 (many diffs) n/a
3 TRCN0000481576 CTCTCTCTTCCCAACTTCCTAGGC pLX_317 23.2% 91.3% 98.4% V5 (many diffs) n/a
4 ccsbBroadEn_15360 pDONR223 0% 84.9% 91% None (many diffs) n/a
5 ccsbBroad304_15360 pLX_304 0% 84.9% 91% V5 (many diffs) n/a
Download CSV