Transcript: Mouse XM_017322124.1

PREDICTED: Mus musculus U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 (U2af2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
U2af2 (22185)
Length:
2121
CDS:
384..1499

Additional Resources:

NCBI RefSeq record:
XM_017322124.1
NBCI Gene record:
U2af2 (22185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294641 GGTAGGAACATAGCGTGTTTA pLKO_005 1846 3UTR 100% 13.200 9.240 N U2af2 n/a
2 TRCN0000315016 GGTAGGAACATAGCGTGTTTA pLKO_005 1846 3UTR 100% 13.200 9.240 N U2AF2 n/a
3 TRCN0000109097 GTGGAGTTCACCTCTGTGTTT pLKO.1 1371 CDS 100% 4.950 3.465 N U2af2 n/a
4 TRCN0000287196 GTGGAGTTCACCTCTGTGTTT pLKO_005 1371 CDS 100% 4.950 3.465 N U2af2 n/a
5 TRCN0000109096 GCCTCATGACTATCAGCCATT pLKO.1 755 CDS 100% 4.050 2.835 N U2af2 n/a
6 TRCN0000287197 GCCTCATGACTATCAGCCATT pLKO_005 755 CDS 100% 4.050 2.835 N U2af2 n/a
7 TRCN0000314894 CCTTTGACCAGAGGCGCTAAA pLKO_005 261 5UTR 100% 10.800 6.480 N U2AF2 n/a
8 TRCN0000109095 GCAACTGGAATGGCAGCAATT pLKO.1 1621 3UTR 100% 10.800 6.480 N U2af2 n/a
9 TRCN0000109099 TGTGCAGATAAATCAAGACAA pLKO.1 635 CDS 100% 4.950 2.970 N U2af2 n/a
10 TRCN0000287135 TGTGCAGATAAATCAAGACAA pLKO_005 635 CDS 100% 4.950 2.970 N U2af2 n/a
11 TRCN0000294694 GAAGAAGAAGGTGCGTAAATA pLKO_005 323 5UTR 100% 15.000 7.500 Y U2af2 n/a
12 TRCN0000109098 CCTAAATGATGACCAGGTAAA pLKO.1 878 CDS 100% 10.800 5.400 Y U2af2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322124.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479556 ACGAAAGCCTCATCTGGTGCATAC pLX_317 20.7% 70.5% 77.2% V5 (many diffs) n/a
2 ccsbBroadEn_07799 pDONR223 100% 70.4% 77.2% None (many diffs) n/a
3 ccsbBroad304_07799 pLX_304 0% 70.4% 77.2% V5 (many diffs) n/a
Download CSV