Transcript: Mouse XM_017322302.1

PREDICTED: Mus musculus RIC3 acetylcholine receptor chaperone (Ric3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ric3 (320360)
Length:
1972
CDS:
89..772

Additional Resources:

NCBI RefSeq record:
XM_017322302.1
NBCI Gene record:
Ric3 (320360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217060 CTGACCAAGAGAAACGATTAC pLKO.1 624 CDS 100% 10.800 15.120 N Ric3 n/a
2 TRCN0000247494 CTGACCAAGAGAAACGATTAC pLKO_005 624 CDS 100% 10.800 15.120 N Ric3 n/a
3 TRCN0000247496 TGCCAGTTGTTTACCTAATTT pLKO_005 792 3UTR 100% 15.000 10.500 N Ric3 n/a
4 TRCN0000191534 GCACAAGTTCTTTCTGATATT pLKO.1 987 3UTR 100% 13.200 9.240 N Ric3 n/a
5 TRCN0000247495 ACAGGAAGATTACCAACTTTG pLKO_005 501 CDS 100% 10.800 7.560 N Ric3 n/a
6 TRCN0000257795 GACTGATGGGCCAGATCATTC pLKO_005 369 CDS 100% 10.800 7.560 N Ric3 n/a
7 TRCN0000247493 TCAACAGAGTTGGACCTAATG pLKO_005 579 CDS 100% 10.800 7.560 N Ric3 n/a
8 TRCN0000191629 GAGCTTGTTCAACTACAAGAA pLKO.1 521 CDS 100% 0.495 0.347 N Ric3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489052 ACCCTCTTGCATGCCTGCACGGGG pLX_317 32.6% 55.1% 55.9% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488694 TTCTCCCTGACTACGATACCCGTC pLX_317 32.7% 54.8% 79.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_08936 pDONR223 100% 54.8% 55.4% None (many diffs) n/a
4 ccsbBroad304_08936 pLX_304 0% 54.8% 55.4% V5 (many diffs) n/a
5 TRCN0000469413 AAACCCGTTCCAAACCATGTGTCA pLX_317 39.7% 54.8% 55.4% V5 (many diffs) n/a
Download CSV