Transcript: Human XM_024446092.1

PREDICTED: Homo sapiens cyclin dependent kinase like 3 (CDKL3), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDKL3 (51265)
Length:
2748
CDS:
866..2653

Additional Resources:

NCBI RefSeq record:
XM_024446092.1
NBCI Gene record:
CDKL3 (51265)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314924 TGACTATCTTCACAGTAATAA pLKO_005 1204 CDS 100% 15.000 21.000 N CDKL3 n/a
2 TRCN0000356141 GTTACGGAACAGTCATGAAAT pLKO_005 906 CDS 100% 13.200 18.480 N CDKL3 n/a
3 TRCN0000314995 TGGTATAGAGCTCCCGAATTA pLKO_005 1358 CDS 100% 13.200 18.480 N CDKL3 n/a
4 TRCN0000356108 ACTAGAGAGTAAGCGACTTAG pLKO_005 1153 CDS 100% 10.800 15.120 N CDKL3 n/a
5 TRCN0000367593 CCACCCATCAATCTAACTAAC pLKO_005 2192 CDS 100% 10.800 15.120 N CDKL3 n/a
6 TRCN0000002379 ACTAACTGTAATGGCTTGAAA pLKO.1 2138 CDS 100% 5.625 7.875 N CDKL3 n/a
7 TRCN0000002380 CCATCAATCTAACTAACAGTA pLKO.1 2196 CDS 100% 4.950 6.930 N CDKL3 n/a
8 TRCN0000314926 ATAGTGGCCATTAAGATATTT pLKO_005 950 CDS 100% 15.000 10.500 N CDKL3 n/a
9 TRCN0000196738 GAGATCAAAGTCAGAGTTATT pLKO.1 1964 CDS 100% 13.200 9.240 N CDKL3 n/a
10 TRCN0000314925 GATTTGGATTTACTCCATAAA pLKO_005 1517 CDS 100% 13.200 9.240 N CDKL3 n/a
11 TRCN0000196777 GCTGCAAATCTCAGTTCAAAT pLKO.1 2225 CDS 100% 13.200 9.240 N CDKL3 n/a
12 TRCN0000195070 CTTTGGGCTGTATGATCATTG pLKO.1 1458 CDS 100% 10.800 7.560 N CDKL3 n/a
13 TRCN0000195206 CCAGAACAATCTGTCAACAAA pLKO.1 980 CDS 100% 5.625 3.938 N CDKL3 n/a
14 TRCN0000002377 GCCACCCATCAATCTAACTAA pLKO.1 2191 CDS 100% 5.625 3.938 N CDKL3 n/a
15 TRCN0000002376 CACACAGTATTAGATGAGTTA pLKO.1 1115 CDS 100% 4.950 3.465 N CDKL3 n/a
16 TRCN0000194700 CAGGATATCATCTAGTGATCT pLKO.1 1720 CDS 100% 4.950 3.465 N CDKL3 n/a
17 TRCN0000314927 ATGGATTGTTGGCAGATATAG pLKO_005 1668 CDS 100% 13.200 7.920 N CDKL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03262 pDONR223 100% 94.7% 95% None (many diffs) n/a
2 ccsbBroad304_03262 pLX_304 0% 94.7% 95% V5 (many diffs) n/a
3 ccsbBroadEn_15062 pDONR223 0% 94.7% 95% None (many diffs) n/a
4 ccsbBroad304_15062 pLX_304 0% 94.7% 95% V5 (many diffs) n/a
5 TRCN0000473541 CGACATTCATACACCTACACCTGC pLX_317 21.4% 94.7% 95% V5 (many diffs) n/a
6 TRCN0000489746 AGCGACCGACGTAAGGTACTCGAG pLX_317 27.6% 76.4% 76.4% V5 540_575del;1402_1785delinsG n/a
7 TRCN0000489363 GTTGGTTGTTCTCCAAGACAACGT pLX_317 30.3% 76.4% 76.4% V5 (not translated due to prior stop codon) 540_575del;1402_1785del n/a
Download CSV