Transcript: Human XM_024446409.1

PREDICTED: Homo sapiens transmembrane protein 14A (TMEM14A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM14A (28978)
Length:
932
CDS:
94..393

Additional Resources:

NCBI RefSeq record:
XM_024446409.1
NBCI Gene record:
TMEM14A (28978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115935 CCTCGTGACATTTGGAAGCAT pLKO.1 123 CDS 100% 3.000 4.200 N TMEM14A n/a
2 TRCN0000115934 CCAATGACAAACGAGATGTAA pLKO.1 233 CDS 100% 5.625 4.500 N TMEM14A n/a
3 TRCN0000291100 CCAATGACAAACGAGATGTAA pLKO_005 233 CDS 100% 5.625 4.500 N TMEM14A n/a
4 TRCN0000115932 GTCACCTCTAATATGAACATT pLKO.1 511 3UTR 100% 5.625 3.938 N TMEM14A n/a
5 TRCN0000307267 GTCACCTCTAATATGAACATT pLKO_005 511 3UTR 100% 5.625 3.938 N TMEM14A n/a
6 TRCN0000115936 GAGATTTAAGAGGTCCAAGAA pLKO.1 300 CDS 100% 4.950 3.465 N TMEM14A n/a
7 TRCN0000291158 GAGATTTAAGAGGTCCAAGAA pLKO_005 300 CDS 100% 4.950 3.465 N TMEM14A n/a
8 TRCN0000115933 CCGTCTTTGATTGCTGGTCTT pLKO.1 172 CDS 100% 4.050 2.835 N TMEM14A n/a
9 TRCN0000307271 CCGTCTTTGATTGCTGGTCTT pLKO_005 172 CDS 100% 4.050 2.835 N TMEM14A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446409.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03053 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03053 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467185 CCCCCTTTTATTGTCTATAGACCC pLX_317 100% 100% 100% V5 n/a
Download CSV