Transcript: Human XM_024446771.1

PREDICTED: Homo sapiens NADH:ubiquinone oxidoreductase subunit A5 (NDUFA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDUFA5 (4698)
Length:
2448
CDS:
1179..1358

Additional Resources:

NCBI RefSeq record:
XM_024446771.1
NBCI Gene record:
NDUFA5 (4698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343498 TTCAATGCAGAGACCATAATC pLKO_005 1635 3UTR 100% 13.200 18.480 N NDUFA5 n/a
2 TRCN0000026467 CTGGCTATGGTTAAAGCGGAA pLKO.1 1173 5UTR 100% 2.160 3.024 N NDUFA5 n/a
3 TRCN0000343495 TCAGTGGAAATGGCCAATATA pLKO_005 1337 CDS 100% 15.000 10.500 N NDUFA5 n/a
4 TRCN0000343551 CCAACTTCAAGGCGGTCAATT pLKO_005 1217 CDS 100% 13.200 9.240 N NDUFA5 n/a
5 TRCN0000343497 GAGAAGCTGGCTATGGTTAAA pLKO_005 1167 5UTR 100% 13.200 9.240 N NDUFA5 n/a
6 TRCN0000026434 GTTCTTGAGGAAATCCCTAAA pLKO.1 1107 5UTR 100% 10.800 7.560 N NDUFA5 n/a
7 TRCN0000026495 CGATCAGTGGAAATGGCCAAT pLKO.1 1334 CDS 100% 4.050 2.835 N NDUFA5 n/a
8 TRCN0000026449 GAGGTGATTCTTCAGGCTGAA pLKO.1 1242 CDS 100% 4.050 2.430 N NDUFA5 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 952 5UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000041818 AGGTGATTCTTCAGGCTGAAA pLKO.1 1243 CDS 100% 4.950 2.970 N Ndufa5 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 953 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446771.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13910 pDONR223 100% 50.5% 50% None 0_1ins171;174delA n/a
2 ccsbBroad304_13910 pLX_304 0% 50.5% 50% V5 (not translated due to frame shift) 0_1ins171;174delA n/a
3 TRCN0000471447 TTAAGTCTTAATGGCGCGCGCACT pLX_317 100% 50.5% 50% V5 (not translated due to frame shift) 0_1ins171;174delA n/a
Download CSV