Transcript: Human XM_024447326.1

PREDICTED: Homo sapiens transmembrane protein 67 (TMEM67), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM67 (91147)
Length:
3960
CDS:
412..2745

Additional Resources:

NCBI RefSeq record:
XM_024447326.1
NBCI Gene record:
TMEM67 (91147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364986 ATTCGACAGTTCGTTGATTTA pLKO_005 2044 CDS 100% 13.200 18.480 N TMEM67 n/a
2 TRCN0000364926 TCCCATTGTGTGTAGTATTTA pLKO_005 2932 3UTR 100% 15.000 10.500 N TMEM67 n/a
3 TRCN0000364927 TGACTTTCCCACTCCTATATT pLKO_005 918 CDS 100% 15.000 10.500 N TMEM67 n/a
4 TRCN0000369943 TTCGAGTTGCTACTCAAATAT pLKO_005 1142 CDS 100% 15.000 10.500 N TMEM67 n/a
5 TRCN0000128198 CAAGGCTAAATGCTGCTTATT pLKO.1 842 CDS 100% 13.200 9.240 N TMEM67 n/a
6 TRCN0000150205 GTGCCTGTGTTAAACCTAAAT pLKO.1 994 CDS 100% 13.200 9.240 N TMEM67 n/a
7 TRCN0000369902 TTACAATGATGAAGGTTATTC pLKO_005 2514 CDS 100% 13.200 9.240 N TMEM67 n/a
8 TRCN0000364925 TTGATGCATGTGGACTATTTC pLKO_005 551 CDS 100% 13.200 9.240 N TMEM67 n/a
9 TRCN0000376511 GCGACAACAACCAGTACTTTG pLKO_005 148 5UTR 100% 10.800 7.560 N TMEM67 n/a
10 TRCN0000147733 GTTGGGTATATGCCAATCTAA pLKO.1 467 CDS 100% 5.625 3.938 N TMEM67 n/a
11 TRCN0000146799 CCATCATTTGTCTCTGTAGAT pLKO.1 3049 3UTR 100% 4.950 3.465 N TMEM67 n/a
12 TRCN0000129134 GTCGTGTTCTTTGCTGTCTTT pLKO.1 1999 CDS 100% 4.950 3.465 N TMEM67 n/a
13 TRCN0000147047 CTCAGTATAATCATGGCCAAA pLKO.1 2770 3UTR 100% 4.050 2.835 N TMEM67 n/a
14 TRCN0000369904 TTCCTATCTCTAAGATCTTAA pLKO_005 896 CDS 100% 13.200 7.920 N TMEM67 n/a
15 TRCN0000148737 CTGCCTGAATCTTCTCACATT pLKO.1 3088 3UTR 100% 4.950 2.970 N TMEM67 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3562 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3563 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12955 pDONR223 100% 78.8% 78.8% None 0_1ins624 n/a
2 ccsbBroad304_12955 pLX_304 0% 78.8% 78.8% V5 0_1ins624 n/a
3 TRCN0000468342 AAGCGGATAATGTGGCTTCTCGGT pLX_317 3.3% 78.8% 78.8% V5 0_1ins624 n/a
Download CSV